ID: 1141904950

View in Genome Browser
Species Human (GRCh38)
Location 16:87018489-87018511
Sequence GTGAACACACGGTAAACTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141904950_1141904957 12 Left 1141904950 16:87018489-87018511 CCCTGAGTTTACCGTGTGTTCAC No data
Right 1141904957 16:87018524-87018546 CCAGAATGAAGATCTAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141904950 Original CRISPR GTGAACACACGGTAAACTCA GGG (reversed) Intergenic
No off target data available for this crispr