ID: 1141906932

View in Genome Browser
Species Human (GRCh38)
Location 16:87033105-87033127
Sequence CCCCGGGGCCGCCCTGGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141906932_1141906944 -5 Left 1141906932 16:87033105-87033127 CCCACGCCAGGGCGGCCCCGGGG No data
Right 1141906944 16:87033123-87033145 CGGGGGGCACAGGGCTGGCCAGG No data
1141906932_1141906945 -4 Left 1141906932 16:87033105-87033127 CCCACGCCAGGGCGGCCCCGGGG No data
Right 1141906945 16:87033124-87033146 GGGGGGCACAGGGCTGGCCAGGG No data
1141906932_1141906940 -10 Left 1141906932 16:87033105-87033127 CCCACGCCAGGGCGGCCCCGGGG No data
Right 1141906940 16:87033118-87033140 GGCCCCGGGGGGCACAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141906932 Original CRISPR CCCCGGGGCCGCCCTGGCGT GGG (reversed) Intergenic