ID: 1141908304

View in Genome Browser
Species Human (GRCh38)
Location 16:87041853-87041875
Sequence AAGGAGAAGTGGAATTAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141908304_1141908313 0 Left 1141908304 16:87041853-87041875 CCCTCCTAATTCCACTTCTCCTT No data
Right 1141908313 16:87041876-87041898 CCTGAAGACACGGCCTAGGAGGG No data
1141908304_1141908314 4 Left 1141908304 16:87041853-87041875 CCCTCCTAATTCCACTTCTCCTT No data
Right 1141908314 16:87041880-87041902 AAGACACGGCCTAGGAGGGTTGG No data
1141908304_1141908311 -1 Left 1141908304 16:87041853-87041875 CCCTCCTAATTCCACTTCTCCTT No data
Right 1141908311 16:87041875-87041897 TCCTGAAGACACGGCCTAGGAGG No data
1141908304_1141908308 -10 Left 1141908304 16:87041853-87041875 CCCTCCTAATTCCACTTCTCCTT No data
Right 1141908308 16:87041866-87041888 ACTTCTCCTTCCTGAAGACACGG No data
1141908304_1141908317 24 Left 1141908304 16:87041853-87041875 CCCTCCTAATTCCACTTCTCCTT No data
Right 1141908317 16:87041900-87041922 TGGGTCCCACAGCATCACAAAGG No data
1141908304_1141908310 -4 Left 1141908304 16:87041853-87041875 CCCTCCTAATTCCACTTCTCCTT No data
Right 1141908310 16:87041872-87041894 CCTTCCTGAAGACACGGCCTAGG No data
1141908304_1141908315 5 Left 1141908304 16:87041853-87041875 CCCTCCTAATTCCACTTCTCCTT No data
Right 1141908315 16:87041881-87041903 AGACACGGCCTAGGAGGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141908304 Original CRISPR AAGGAGAAGTGGAATTAGGA GGG (reversed) Intergenic
No off target data available for this crispr