ID: 1141909849

View in Genome Browser
Species Human (GRCh38)
Location 16:87051219-87051241
Sequence GTGTGTGTGTACATGTATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141909846_1141909849 5 Left 1141909846 16:87051191-87051213 CCCCTTGTGTGTGTGTGTGTGTG 0: 39
1: 796
2: 3669
3: 3689
4: 5886
Right 1141909849 16:87051219-87051241 GTGTGTGTGTACATGTATGTTGG No data
1141909847_1141909849 4 Left 1141909847 16:87051192-87051214 CCCTTGTGTGTGTGTGTGTGTGT 0: 604
1: 3257
2: 3235
3: 4698
4: 8502
Right 1141909849 16:87051219-87051241 GTGTGTGTGTACATGTATGTTGG No data
1141909848_1141909849 3 Left 1141909848 16:87051193-87051215 CCTTGTGTGTGTGTGTGTGTGTG 0: 1789
1: 2002
2: 2702
3: 4398
4: 7597
Right 1141909849 16:87051219-87051241 GTGTGTGTGTACATGTATGTTGG No data
1141909845_1141909849 16 Left 1141909845 16:87051180-87051202 CCAAAGTCAGTCCCCTTGTGTGT No data
Right 1141909849 16:87051219-87051241 GTGTGTGTGTACATGTATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141909849 Original CRISPR GTGTGTGTGTACATGTATGT TGG Intergenic
No off target data available for this crispr