ID: 1141910211

View in Genome Browser
Species Human (GRCh38)
Location 16:87053512-87053534
Sequence ACTGCTGGCGGCAAGCTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141910206_1141910211 -10 Left 1141910206 16:87053499-87053521 CCCCGGGGAGCACACTGCTGGCG No data
Right 1141910211 16:87053512-87053534 ACTGCTGGCGGCAAGCTTGGAGG No data
1141910197_1141910211 13 Left 1141910197 16:87053476-87053498 CCAGGTTCTCACCGCCGGCATCC No data
Right 1141910211 16:87053512-87053534 ACTGCTGGCGGCAAGCTTGGAGG No data
1141910201_1141910211 2 Left 1141910201 16:87053487-87053509 CCGCCGGCATCCCCCCGGGGAGC No data
Right 1141910211 16:87053512-87053534 ACTGCTGGCGGCAAGCTTGGAGG No data
1141910205_1141910211 -9 Left 1141910205 16:87053498-87053520 CCCCCGGGGAGCACACTGCTGGC No data
Right 1141910211 16:87053512-87053534 ACTGCTGGCGGCAAGCTTGGAGG No data
1141910196_1141910211 14 Left 1141910196 16:87053475-87053497 CCCAGGTTCTCACCGCCGGCATC No data
Right 1141910211 16:87053512-87053534 ACTGCTGGCGGCAAGCTTGGAGG No data
1141910203_1141910211 -8 Left 1141910203 16:87053497-87053519 CCCCCCGGGGAGCACACTGCTGG No data
Right 1141910211 16:87053512-87053534 ACTGCTGGCGGCAAGCTTGGAGG No data
1141910202_1141910211 -1 Left 1141910202 16:87053490-87053512 CCGGCATCCCCCCGGGGAGCACA No data
Right 1141910211 16:87053512-87053534 ACTGCTGGCGGCAAGCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141910211 Original CRISPR ACTGCTGGCGGCAAGCTTGG AGG Intergenic
No off target data available for this crispr