ID: 1141910411

View in Genome Browser
Species Human (GRCh38)
Location 16:87054754-87054776
Sequence AGCTCTATTTTCCACTTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141910411_1141910421 29 Left 1141910411 16:87054754-87054776 CCATAAAAGTGGAAAATAGAGCT No data
Right 1141910421 16:87054806-87054828 CAGAGGGTGGAGGGATAGATGGG No data
1141910411_1141910417 16 Left 1141910411 16:87054754-87054776 CCATAAAAGTGGAAAATAGAGCT No data
Right 1141910417 16:87054793-87054815 GAAGAAACGGATGCAGAGGGTGG No data
1141910411_1141910418 19 Left 1141910411 16:87054754-87054776 CCATAAAAGTGGAAAATAGAGCT No data
Right 1141910418 16:87054796-87054818 GAAACGGATGCAGAGGGTGGAGG No data
1141910411_1141910419 20 Left 1141910411 16:87054754-87054776 CCATAAAAGTGGAAAATAGAGCT No data
Right 1141910419 16:87054797-87054819 AAACGGATGCAGAGGGTGGAGGG No data
1141910411_1141910420 28 Left 1141910411 16:87054754-87054776 CCATAAAAGTGGAAAATAGAGCT No data
Right 1141910420 16:87054805-87054827 GCAGAGGGTGGAGGGATAGATGG No data
1141910411_1141910414 3 Left 1141910411 16:87054754-87054776 CCATAAAAGTGGAAAATAGAGCT No data
Right 1141910414 16:87054780-87054802 AGAGGAAGTCATAGAAGAAACGG No data
1141910411_1141910415 12 Left 1141910411 16:87054754-87054776 CCATAAAAGTGGAAAATAGAGCT No data
Right 1141910415 16:87054789-87054811 CATAGAAGAAACGGATGCAGAGG No data
1141910411_1141910416 13 Left 1141910411 16:87054754-87054776 CCATAAAAGTGGAAAATAGAGCT No data
Right 1141910416 16:87054790-87054812 ATAGAAGAAACGGATGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141910411 Original CRISPR AGCTCTATTTTCCACTTTTA TGG (reversed) Intergenic
No off target data available for this crispr