ID: 1141910419

View in Genome Browser
Species Human (GRCh38)
Location 16:87054797-87054819
Sequence AAACGGATGCAGAGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141910411_1141910419 20 Left 1141910411 16:87054754-87054776 CCATAAAAGTGGAAAATAGAGCT No data
Right 1141910419 16:87054797-87054819 AAACGGATGCAGAGGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141910419 Original CRISPR AAACGGATGCAGAGGGTGGA GGG Intergenic
No off target data available for this crispr