ID: 1141910423

View in Genome Browser
Species Human (GRCh38)
Location 16:87054831-87054853
Sequence CCTTCGTCTTCAAAGACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141910423_1141910427 3 Left 1141910423 16:87054831-87054853 CCTGCTGTCTTTGAAGACGAAGG No data
Right 1141910427 16:87054857-87054879 GGGCCATGAGCCAAAGAATGAGG 0: 6
1: 67
2: 208
3: 326
4: 618
1141910423_1141910431 20 Left 1141910423 16:87054831-87054853 CCTGCTGTCTTTGAAGACGAAGG No data
Right 1141910431 16:87054874-87054896 ATGAGGCAGCCTCTGGAAGCTGG No data
1141910423_1141910430 13 Left 1141910423 16:87054831-87054853 CCTGCTGTCTTTGAAGACGAAGG No data
Right 1141910430 16:87054867-87054889 CCAAAGAATGAGGCAGCCTCTGG No data
1141910423_1141910432 26 Left 1141910423 16:87054831-87054853 CCTGCTGTCTTTGAAGACGAAGG No data
Right 1141910432 16:87054880-87054902 CAGCCTCTGGAAGCTGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141910423 Original CRISPR CCTTCGTCTTCAAAGACAGC AGG (reversed) Intergenic
No off target data available for this crispr