ID: 1141910427

View in Genome Browser
Species Human (GRCh38)
Location 16:87054857-87054879
Sequence GGGCCATGAGCCAAAGAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1225
Summary {0: 6, 1: 67, 2: 208, 3: 326, 4: 618}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141910423_1141910427 3 Left 1141910423 16:87054831-87054853 CCTGCTGTCTTTGAAGACGAAGG No data
Right 1141910427 16:87054857-87054879 GGGCCATGAGCCAAAGAATGAGG 0: 6
1: 67
2: 208
3: 326
4: 618
1141910422_1141910427 4 Left 1141910422 16:87054830-87054852 CCCTGCTGTCTTTGAAGACGAAG No data
Right 1141910427 16:87054857-87054879 GGGCCATGAGCCAAAGAATGAGG 0: 6
1: 67
2: 208
3: 326
4: 618

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141910427 Original CRISPR GGGCCATGAGCCAAAGAATG AGG Intergenic
900905597 1:5554910-5554932 GGGCCATGAACCAGGGAAGGTGG - Intergenic
900910259 1:5592356-5592378 GGGCCACAAGCCAAGGAGTGTGG + Intergenic
900915749 1:5637225-5637247 GGGCCATAATCCAATGACTGTGG + Intergenic
901028151 1:6290130-6290152 GGACCATGAGCCGAGGAATGTGG + Intronic
901414270 1:9106013-9106035 GGGCTATGGGACAAAGAAAGGGG - Intronic
902250324 1:15150805-15150827 GGGTCAGTAGCCAAGGAATGTGG - Intergenic
902524148 1:17043757-17043779 AGGCCAAGAGCCAAGGAGTGCGG + Intronic
902567248 1:17320166-17320188 GGGCCACAAGCCAAGGAATGCGG - Intronic
903316948 1:22515553-22515575 TGGCCAAGAGCCAGGGAATGCGG - Intronic
903382534 1:22906974-22906996 GGGCCAGGGGCCCATGAATGGGG + Intronic
903403244 1:23073653-23073675 GGGCCAGGAGCCAGAGCATGGGG - Intronic
904312370 1:29637153-29637175 GGGACATGAGCCAAGGAATGTGG - Intergenic
904951382 1:34242278-34242300 GGGCCATGAGCCAAGGACTGTGG + Intergenic
905541227 1:38762075-38762097 GGGCCATGAGGCAAGGAATGTGG - Intergenic
905635746 1:39550846-39550868 GGGCCAAGAGCCAAATAATGTGG + Intergenic
905855394 1:41308198-41308220 TGGCCATGAGCCAAGGAATGTGG - Intergenic
905998450 1:42402492-42402514 GGGCCATGAGCCAAGGAATGTGG + Intronic
906165168 1:43680661-43680683 GGTCCAGGAGCCAAGGAATGTGG - Intronic
906556083 1:46715558-46715580 GGGCCATTTGAGAAAGAATGTGG - Intronic
906771208 1:48486470-48486492 GAGCAATGAACCAAAGAATGAGG + Intergenic
908068064 1:60429171-60429193 GGGCCATCAACCAAGGAATATGG + Intergenic
908992089 1:70103484-70103506 GGATCATGAGCCTAGGAATGTGG + Intronic
909145379 1:71923709-71923731 GGACCCTGAGCCAAGGAATATGG - Intronic
909162600 1:72172805-72172827 GGGTCATGAGCCAAATAAGGTGG - Intronic
909327137 1:74364783-74364805 GGGCTACAAGCCAAGGAATGTGG + Intronic
909570309 1:77102521-77102543 GGGTCATGAGCCATAGGATGTGG + Intronic
909686384 1:78353941-78353963 GGACCATGAGCCAAGGAATGAGG - Intronic
909848439 1:80428940-80428962 GGACCCTGAGGCATAGAATGGGG - Intergenic
910053095 1:82999313-82999335 GGGTCATGAGCCAAGAAACGTGG - Intergenic
910671281 1:89775290-89775312 GGACCATGAGCCAAGGAACAGGG + Intronic
910751709 1:90638116-90638138 AAGTCATGAGCCAAGGAATGTGG + Intergenic
911101506 1:94099287-94099309 AGACCACTAGCCAAAGAATGTGG + Intronic
911658883 1:100477027-100477049 GAGCCATAAGCCAAGGAATATGG + Intronic
912015612 1:105030845-105030867 GGGTCATGAGCCAAAAACTGAGG + Intergenic
912148890 1:106831700-106831722 TGGCTGTGAGCCAAGGAATGTGG - Intergenic
912256299 1:108061923-108061945 GGGCCACAAGCCAAAGGATGTGG + Intergenic
912579382 1:110706359-110706381 GGGCCAGGAGCCAAGAGATGGGG - Intergenic
913182732 1:116337740-116337762 GGTCCATAAGCCAAGGAATGTGG - Intergenic
914319787 1:146548091-146548113 GGGCCATGAGCCAAGGAATGTGG - Intergenic
914708506 1:150191342-150191364 GGGCCATGAGCCAAGGAATTCGG + Intergenic
915344901 1:155192484-155192506 GGGCCATGAGCCAAGGCCTATGG - Intronic
915513239 1:156398501-156398523 GGGCAAGGAGACAAAGAATGAGG - Intergenic
915908922 1:159900192-159900214 GGGGCCTGAGCCGAAGAACGCGG - Intergenic
916034776 1:160912128-160912150 GAGCCATGAGCTAAGGAGTGTGG - Intergenic
916338011 1:163694917-163694939 GGGCCATGAGCCAAGGAATGTGG + Intergenic
916472087 1:165134021-165134043 GAACCATGAGCCAAGAAATGTGG + Intergenic
917253319 1:173086960-173086982 GAGCCTTGAGACAAAGAATTTGG - Intergenic
917781847 1:178405573-178405595 AGGCCATGAGCCAAGGAATGTGG + Intronic
918084148 1:181230996-181231018 GGGCCATAAGCCAAGGAATGCGG - Intergenic
918153442 1:181819173-181819195 AGGCCATGAGCAAAAGAATGTGG - Intergenic
918295484 1:183152313-183152335 GGGGCACGAGCCAAGGAATGTGG + Intergenic
918333794 1:183487247-183487269 GGGCCATGAGCTAAGGAATGTGG - Intronic
918399224 1:184146945-184146967 GGGCTGTGAGCCAAGGAATGTGG - Intergenic
918593515 1:186266175-186266197 GGACCATGCGCTAAAGAACGTGG - Intergenic
918687062 1:187430132-187430154 GGACCACAAGCCAAGGAATGTGG + Intergenic
919187803 1:194176460-194176482 ACCACATGAGCCAAAGAATGTGG - Intergenic
919294679 1:195681298-195681320 GGGCCACAAGCCAAGGAATTGGG - Intergenic
919497120 1:198286841-198286863 AAGCCAGGAGCCAAGGAATGAGG - Intronic
919500860 1:198336746-198336768 GGGCCATGAACCAAAGAAAGTGG - Intergenic
919588878 1:199474252-199474274 GGGCCATGAGCCAAGGAATATGG - Intergenic
920056820 1:203198850-203198872 GAGCCACGAGCCAAGGGATGCGG + Intergenic
920411014 1:205760864-205760886 GAACCATGAGCCAAGGAATGTGG + Intergenic
920659146 1:207900617-207900639 AGGCCATGAGCAAAAGGATGAGG - Intronic
921275307 1:213513188-213513210 GGGCCATGAGCCAAGGAATGTGG + Intergenic
921668946 1:217905453-217905475 GGGTCATGATCCAAGGAATGCGG + Intergenic
921927720 1:220726278-220726300 AGGGCATGAGCCCAAGAATGTGG - Intergenic
922101804 1:222483195-222483217 GGGCTATGATCCAAGGAATGGGG - Intergenic
922108662 1:222535617-222535639 GGGCCATGAGTCAAGGCATAGGG - Intronic
922262886 1:223958316-223958338 GGGCTATGATCCAAGGAATGGGG - Intergenic
922349640 1:224724614-224724636 GCCCCAGGAGCCAAAGAGTGTGG - Intronic
922895382 1:229096185-229096207 TGGCCACAAGCCAAGGAATGTGG - Intergenic
923073266 1:230585359-230585381 GGGCCACGAGTCAAGGAATGTGG + Intergenic
923101435 1:230820907-230820929 GGTCCATGGGCCAAGGATTGGGG - Intergenic
923144701 1:231189878-231189900 GGGCCGCAAGCCAAGGAATGTGG + Intronic
924344724 1:243063317-243063339 GGGCCATGATCCAAGGAATGGGG - Intergenic
924502351 1:244649623-244649645 GAGCCATGAGCCAAGGAATGAGG + Intergenic
924530358 1:244888664-244888686 GGGCCACAAGCCAAGGAATGTGG + Intergenic
924811316 1:247405061-247405083 GGGCCACGAGCTAAGGAATAAGG - Intergenic
1063163454 10:3438227-3438249 GGGCCATGAGCCCAGGAATGTGG - Intergenic
1063254163 10:4308147-4308169 GGGCCATGTGCCAAGGAACGTGG - Intergenic
1063811853 10:9720263-9720285 GGGCCATGAAGCATAGAATGTGG + Intergenic
1064706226 10:18075066-18075088 GGGCCATGAACCAAGGAATGGGG + Intergenic
1065316946 10:24472883-24472905 GGGCCATGAGCCAAGGAATGTGG - Intronic
1066011725 10:31200663-31200685 CGGCCATGAGCCAAAGAATGTGG + Intergenic
1066731608 10:38441757-38441779 GGGCCGTGATCCAAGGAATGGGG + Intergenic
1067007797 10:42681157-42681179 GGGCCATGAGCCAAGAAATGGGG - Intergenic
1067035693 10:42914793-42914815 GGGCCACTAGCCAAGGAGTGTGG - Intergenic
1067538684 10:47136026-47136048 GGGCCAGGAGGCAGAGAAGGTGG - Intergenic
1068286163 10:54938890-54938912 GGGCCATAAGCAAAGGATTGTGG + Intronic
1068415763 10:56720267-56720289 GAGCCATGAACCAAGGAATGTGG - Intergenic
1068424913 10:56847369-56847391 AGGCCATAAACCAAGGAATGTGG + Intergenic
1068465467 10:57384333-57384355 GGCCCATGAGCCAAGAAATGCGG - Intergenic
1068554218 10:58440039-58440061 GGGCCACAAGCCAAAGAATGTGG - Intergenic
1068599968 10:58946493-58946515 GGGCCACTAGCCAAGAAATGTGG - Intergenic
1068633359 10:59321325-59321347 GGACCATAAGCCATGGAATGTGG + Intronic
1068717071 10:60200395-60200417 GGTCCATGAGGCAAAGACTTTGG + Intronic
1068820294 10:61368597-61368619 TGACCATGAGCCAAGGAATGTGG - Intergenic
1069018731 10:63462694-63462716 GGGCCATGAGCCAAGGAATGTGG + Intronic
1069038502 10:63670312-63670334 AGGCCAGGAGCCAAAGAGGGAGG - Intergenic
1069086574 10:64146865-64146887 GAGTCATGAACCAAAGAATGTGG + Intergenic
1069321473 10:67176834-67176856 GGGCCATGAGCCAAGGAATGAGG + Intronic
1069510124 10:69035961-69035983 GGGCCACAAGCCAAGCAATGTGG - Intergenic
1069869538 10:71524797-71524819 AGGACAGGAGCCAAAGAATGTGG + Intronic
1070265954 10:74903460-74903482 GGACCATGTGCCAAGCAATGTGG + Intronic
1070470477 10:76774368-76774390 GGGCCATTAGCCAAGGAATGTGG + Intergenic
1070499710 10:77060857-77060879 GGGACAAGAGCCAAGGAATGTGG + Intronic
1070565609 10:77601845-77601867 GGACCAAGAGCCAAAGCAGGTGG + Intronic
1070686622 10:78489505-78489527 GGACCACAAGCCAAGGAATGTGG - Intergenic
1071912054 10:90247520-90247542 GGGCCATAAGCCAAGGAAAGTGG + Intergenic
1071946773 10:90654924-90654946 GGGCCTTGAGCCTCAGACTGAGG - Intergenic
1072000869 10:91194410-91194432 GGGCCACTGGCCAAGGAATGTGG + Intronic
1072169599 10:92846999-92847021 GGGCCACAAGCCAAGGTATGTGG + Intronic
1072578690 10:96721742-96721764 AGGCCATGAGCCAAGGAATGTGG - Intergenic
1072753779 10:98003463-98003485 AGGCCAAGAGCCGAGGAATGTGG - Intronic
1072764166 10:98082527-98082549 GGGCAATGAGCCAAGGCTTGAGG - Intergenic
1072911894 10:99509520-99509542 GGGCTACCAGCCAAGGAATGTGG + Intergenic
1073058483 10:100717717-100717739 TGGTCATGAGCCAAGGAATGTGG + Intergenic
1073363660 10:102919302-102919324 GGGCCATGAGCCCCAGGTTGAGG - Exonic
1073598573 10:104823986-104824008 GGACCATGAGTCAAGGAATGGGG + Intronic
1073651729 10:105367589-105367611 CAGACATGAGCCAAGGAATGTGG - Intergenic
1073741303 10:106410193-106410215 GGGTCATGAGCCAAAGAGTGTGG + Intergenic
1074414276 10:113253530-113253552 TGGCCAAGAGCCAGAGAATATGG - Intergenic
1074439024 10:113458823-113458845 AAGCCATGAGCCAAGGAATGCGG - Intergenic
1074472727 10:113742151-113742173 GGGCCAGGAGCCAAGGAATGTGG - Intergenic
1074599759 10:114901636-114901658 GGGCCCTGAACCAAGGCATGGGG - Intergenic
1074604476 10:114947133-114947155 GGATCACAAGCCAAAGAATGGGG + Intronic
1074645024 10:115439810-115439832 GGACCATGAGCCAACAAATGAGG + Intronic
1074700169 10:116085647-116085669 GGGCCTTCATCCCAAGAATGTGG - Intronic
1074861381 10:117512815-117512837 GGGCCAAGTGCCAGAGAAGGAGG - Intergenic
1075143628 10:119864136-119864158 GGGCCACAAGCCAAGAAATGTGG + Intronic
1075421722 10:122306190-122306212 GGGCCATAAGCAAAGGAATGTGG + Intronic
1075552080 10:123400218-123400240 GGGCCAAGACACAAAGAGTGAGG - Intergenic
1075930398 10:126290132-126290154 GAGCCATGAGCCAAGGAACCTGG + Intronic
1076083490 10:127605110-127605132 GGGCCATGAGCCAAGCAATGTGG - Intergenic
1076686118 10:132199190-132199212 GGGCCCTGAGGCAAAACATGGGG + Intronic
1077467553 11:2740727-2740749 GGGCCATGATCCAAGGGATGTGG - Intronic
1077484163 11:2831281-2831303 GGGCCATGAGAAGAAGTATGTGG + Intronic
1077865772 11:6220196-6220218 GGGCCATGAGCCAAGGAATCTGG + Intronic
1078899251 11:15626205-15626227 GAGCCATGAGCTAAAGAAAGTGG - Intergenic
1079022095 11:16917537-16917559 TGCCCTTGAGCCAAGGAATGTGG - Intronic
1079326891 11:19501056-19501078 GAGCCATGAACAAAGGAATGTGG - Intronic
1079461402 11:20681831-20681853 CAGCCATGAGCCAAGGAATGTGG - Intronic
1079649309 11:22906898-22906920 GGGTCATAAGCCAAAGGATGTGG + Intergenic
1080050064 11:27850656-27850678 AAGCTATGAGCCAAGGAATGTGG - Intergenic
1080109853 11:28554386-28554408 GGGACATGAGCCAAGGAATGAGG - Intergenic
1080247895 11:30200000-30200022 GGGCCACAAGTCAAGGAATGTGG + Intergenic
1080269286 11:30433979-30434001 GGGCCAGGAGCCAAGGAATGTGG - Intronic
1080448970 11:32363155-32363177 AGGCCACGAGCCAAGAAATGTGG - Intergenic
1080709742 11:34735172-34735194 GGGTCATGAGTGAAGGAATGTGG + Intergenic
1080824963 11:35840293-35840315 CACCCATGAGCCAAGGAATGTGG - Intergenic
1080871976 11:36244388-36244410 TGGCCACGAGACAAAGAATGTGG - Intergenic
1081017153 11:37896597-37896619 GGGCCAGGAGGCAAGGAATATGG + Intergenic
1081104835 11:39053560-39053582 AGGCCATGAGCCAAGGAATGTGG - Intergenic
1081270411 11:41076681-41076703 GGGCCATGGGCAAAATGATGTGG - Intronic
1081327048 11:41757613-41757635 GGACAATGAGCCAAGAAATGTGG - Intergenic
1081488708 11:43550353-43550375 GGCCAAGGAGCCAAAGAAGGGGG + Intergenic
1081698961 11:45140376-45140398 GGGCCAGGAGCCAAGAGATGTGG - Intronic
1081955824 11:47091804-47091826 GGGCCACAAGCCAAGGAATGAGG + Intronic
1082693720 11:56333881-56333903 GGGACATGAGCAAAAAAAAGTGG - Intergenic
1083058744 11:59847850-59847872 GGGCCATGAGCCATGCAACGTGG + Intergenic
1083352683 11:62042135-62042157 GGGCCTTGAAGGAAAGAATGTGG + Intergenic
1083402103 11:62430664-62430686 GGGCCATGAGCCAAGTAATGCGG - Intergenic
1084404297 11:68962103-68962125 GGGCCCTGAGCCACAGAACAGGG + Intergenic
1084702373 11:70795818-70795840 GGGCCATGAGCCAAGGATGTCGG + Intronic
1084793597 11:71490171-71490193 GCGTCGTGAGCCAAAGAAGGCGG - Intronic
1085196405 11:74674706-74674728 GGGCCATGAGCCAAGGAATGCGG - Intergenic
1085275403 11:75295403-75295425 GGGCCATGAGCCAAGGAATGTGG - Intronic
1085316727 11:75549558-75549580 GGGCCACAAGTCAAGGAATGCGG + Intergenic
1085407921 11:76275024-76275046 GGGCCACTAGCCAAGGAGTGCGG + Intergenic
1085577530 11:77620425-77620447 GGGCAATTAGCAAAAGAAAGAGG - Intronic
1085788632 11:79476635-79476657 GGGTCATGAGCCAAGGAATGTGG - Intergenic
1086021387 11:82234416-82234438 GGGCCATGATCCAAGCAACGTGG - Intergenic
1086025625 11:82287285-82287307 GGGCCACAAACCAAAAAATGGGG - Intergenic
1086445284 11:86864802-86864824 GGGCCACCATCCAAGGAATGAGG - Intronic
1086817382 11:91389805-91389827 TGGCCATGAACTGAAGAATGTGG - Intergenic
1086853547 11:91839506-91839528 GGGACATTAGCCAAGGAATGTGG - Intergenic
1087229517 11:95644625-95644647 GGGTCATGAGCCAAGGACTATGG + Intergenic
1087301933 11:96446221-96446243 GGGCCATGTAGCAAGGAATGTGG - Intronic
1087351309 11:97036068-97036090 GGGCCATGAGTCAAGGGAAGTGG + Intergenic
1088023543 11:105150247-105150269 GAGCCATGAGCTAAAAAATTTGG - Intergenic
1088062379 11:105670958-105670980 GGGCCACAAGCCAAGCAATGAGG - Intronic
1088090428 11:106032296-106032318 AGCCCATGAGCCAAAGAATAGGG + Intergenic
1088559739 11:111101270-111101292 GAGCCATGAGCCAAGAAACGTGG + Intergenic
1088572515 11:111236796-111236818 GGGCCATGAGCAAAGGAACACGG - Intergenic
1089838333 11:121391677-121391699 TGGCCACAAGCCAAAGAATGCGG - Intergenic
1089949562 11:122512649-122512671 AGGCCAGGAGCCAAGGAATGTGG - Intergenic
1090082699 11:123624615-123624637 GGGCTCTGAGCCAAAGAAGGAGG + Intronic
1090671813 11:128952851-128952873 CTGCCATGAGCCCAGGAATGTGG - Intergenic
1090969588 11:131628876-131628898 GGGCCATGAGCCCAAGAGCCAGG + Intronic
1091345325 11:134848863-134848885 GGGCCACCAGCCAAGGAATGCGG - Intergenic
1091621314 12:2091493-2091515 GGGCCATGAGCCAAGGAATGTGG - Intronic
1092001580 12:5037010-5037032 GGGCCATGAGCCAAGGAATATGG + Intergenic
1092179939 12:6439535-6439557 AGGCCATGAGCCTCAGTATGTGG - Intergenic
1092293209 12:7177681-7177703 GTGCCATGAACCAAAGAATCAGG + Intergenic
1093003945 12:14031957-14031979 GGGCCATGAGCCAAGGAATATGG + Intergenic
1093152153 12:15634711-15634733 GTGCCATGAGGGAACGAATGTGG + Intronic
1093211773 12:16316621-16316643 GGATCATGCGTCAAAGAATGTGG + Intergenic
1093378588 12:18461913-18461935 AGGACATGAGCCAAGGAATGTGG - Intronic
1093398011 12:18706988-18707010 TGGCCACAAGCCAAGGAATGTGG - Intronic
1093596561 12:20969245-20969267 GGGCCATGAGCCAAGGAATTTGG - Intergenic
1093751264 12:22803193-22803215 AGGTCATGAGCCAAGAAATGTGG - Intergenic
1093941151 12:25056236-25056258 GGGAAATGAGCCAAAGAAGGCGG + Intronic
1094203054 12:27812689-27812711 GGGCCATGTGGCAAGGAGTGTGG + Intergenic
1094367790 12:29702467-29702489 GGGCCATGTGCCAGGGAATGAGG - Intronic
1094383823 12:29872398-29872420 GGGCTTTGAGGGAAAGAATGTGG + Intergenic
1094585323 12:31772416-31772438 GGGCTGTGAGCCAAGGAATGTGG - Intergenic
1094799452 12:34016316-34016338 GGGGAATGAGACAAAGCATGGGG - Intergenic
1095168621 12:39006129-39006151 GGGCCATGAGCCAAGGAGTGTGG + Intergenic
1095671034 12:44860546-44860568 TGGCCATGAGTCAAGAAATGTGG - Intronic
1095672765 12:44879139-44879161 GGGCTATGAGACAAGGAATATGG + Intronic
1095739914 12:45595447-45595469 GTGCCACAAGCTAAAGAATGTGG - Intergenic
1096110806 12:49028024-49028046 AGGCACTGAGCCAAAGAAGGGGG - Exonic
1096546501 12:52343805-52343827 GGGCCACAAGCCAAGGAATGTGG - Intergenic
1096572137 12:52529600-52529622 GGGCCATGAGCCAGGGAATGTGG + Intergenic
1096872415 12:54601668-54601690 GGGCCATGGGCCAAAGACTGTGG + Intergenic
1097429499 12:59487003-59487025 GGGCAGTAAGCCAAATAATGAGG - Intergenic
1097631064 12:62062867-62062889 GGGCCATGAGCCAAGGAATGCGG - Intronic
1097647469 12:62253587-62253609 GGGCCATGAGCCAAGGAATGTGG - Intronic
1097762058 12:63477716-63477738 GGGCCATAAGTCAAGAAATGTGG + Intergenic
1098022559 12:66170822-66170844 GGGACAGGTGGCAAAGAATGAGG + Intergenic
1098130916 12:67348879-67348901 GGGCCATGAGCCCAGGAATGTGG - Intergenic
1098419941 12:70284673-70284695 CGGCAATGAGCCAACCAATGAGG - Intronic
1098445987 12:70565992-70566014 GGGACACGAGCCAAGGAATGTGG + Intronic
1098473258 12:70869729-70869751 GGACCATTAGCCAAGGAATGAGG + Intronic
1098822444 12:75250017-75250039 GGGCCAGGGGCCAACAAATGTGG - Intergenic
1099659948 12:85544835-85544857 GTGCTCTGAGCCAAGGAATGTGG + Intergenic
1099734903 12:86554942-86554964 GGGCCATAAGCTAAGGAATTCGG - Intronic
1099833247 12:87873089-87873111 GGGCAATGAGCCAAGAAATGTGG - Intergenic
1100108346 12:91205995-91206017 GGGCTATGAGCCACAGAATGTGG - Intergenic
1100266590 12:92982488-92982510 GGGCCTTCAGCCACAGAGTGAGG + Intergenic
1100432431 12:94542572-94542594 GGGCCATGAGCCAAGGAACATGG + Intergenic
1100697879 12:97115329-97115351 GGTACATGAGACACAGAATGTGG + Intergenic
1100939829 12:99714138-99714160 TAGCCATGAGCCATGGAATGCGG - Intronic
1101315316 12:103623552-103623574 GAGCCATGAGCCAAGGAATGTGG + Intronic
1101573017 12:105972423-105972445 GGGCCATGAGCCAAGGAATATGG + Intergenic
1101740809 12:107498574-107498596 GGTCCATGAGCCAAGGAATGTGG - Intronic
1101807772 12:108079891-108079913 GTGCCATGAGCCAATCATTGTGG + Intergenic
1101815308 12:108141534-108141556 GGGCTATGAACCAAGGAATATGG - Intronic
1101817206 12:108154339-108154361 GGGTCATGACCCAAGGGATGTGG - Intronic
1101841643 12:108331773-108331795 GGACCATGAGTCAAGGAATGTGG + Intronic
1102182802 12:110924901-110924923 GGACCACGAACCAAGGAATGTGG - Intergenic
1102445754 12:113001579-113001601 GGGCCATGAGCCAAGAAATTTGG - Intronic
1102451073 12:113042568-113042590 GGGCCCTGCGCCAAGGAATAAGG + Intergenic
1102560518 12:113758838-113758860 GGACCATGAGCCAAGGATTAAGG + Intergenic
1102560607 12:113759501-113759523 GGGCCATGAGCCAAGGATTAAGG + Intergenic
1102697020 12:114807951-114807973 GGGCCATGAGCCAAGGAATGTGG + Intergenic
1102722350 12:115028180-115028202 GGAACATAAGCCAAACAATGGGG - Intergenic
1102813284 12:115842367-115842389 AGGCCATGAATCAAGGAATGCGG + Intergenic
1102827465 12:115961531-115961553 GGAACATGAGACAAAGGATGAGG - Intronic
1102975082 12:117201010-117201032 GGGCAGTGAGTCAAGGAATGTGG + Intergenic
1103061736 12:117863817-117863839 GGGCCAGAAGCCAAGGGATGCGG - Intronic
1103305000 12:119957009-119957031 GGGCCACTAGCCAAGGGATGGGG + Intergenic
1103981556 12:124740056-124740078 GGGCCATGAGCCTAGGAGTGCGG - Intergenic
1103996373 12:124833035-124833057 GGGACAGGAGCCAAGGAATGCGG - Intronic
1104081479 12:125434157-125434179 GGGCCACCCGCCAAGGAATGTGG - Intronic
1104293831 12:127493935-127493957 GGGCCAGGAGCCAAGGAATGTGG - Intergenic
1104341941 12:127958523-127958545 GGGCCAGAGGCCAATGAATGTGG - Intergenic
1104354757 12:128075562-128075584 GGGCCGTGAGCCAAGGAATGTGG + Intergenic
1104372194 12:128233826-128233848 TGACCATGAGCCAAGGGATGCGG - Intergenic
1104432267 12:128726105-128726127 GGGCCTTGAGTCAAGGAATGTGG + Intergenic
1104453005 12:128886580-128886602 GGGCCATGAGCCAAGACATGTGG - Intronic
1104525488 12:129516905-129516927 GGGCCAGGAGCCAAGGAATGTGG - Intronic
1105706420 13:22970266-22970288 TGCCCATGGGACAAAGAATGAGG + Intergenic
1105814651 13:24023729-24023751 AGGCCATGAGCCAAGGAATGTGG + Intronic
1106139881 13:27003262-27003284 GGGCCACAAGCCAACAAATGTGG + Intergenic
1106399287 13:29412932-29412954 GGGCCATGAGTCCAGGAATATGG - Intronic
1106454733 13:29917155-29917177 GGGCCATGAGCCAAGGGGTGGGG + Intergenic
1106670648 13:31901034-31901056 GGGCCGAGAGCCAAGGAAAGTGG - Intergenic
1106775329 13:33003193-33003215 CAGCCATGAGCCAAGGAATGCGG - Intergenic
1106959064 13:34976411-34976433 GGGACTTGGGGCAAAGAATGGGG + Intronic
1107260873 13:38489564-38489586 GGCCCATGAGCCAAGGAATATGG + Intergenic
1107279638 13:38719165-38719187 GGGCTATGAGCCAAGGAAAGTGG - Intronic
1107691771 13:42960753-42960775 GGGCCATTAGCCCAGGAATGTGG - Intronic
1108033074 13:46257147-46257169 GAGCCATGAGTCAAGGAATGAGG + Intronic
1108111882 13:47082423-47082445 AGGCCACAAGCCAAGGAATGTGG - Intergenic
1108132765 13:47320803-47320825 GGCTCATGAGCCAAAGAGTGGGG + Intergenic
1108212281 13:48150732-48150754 GGGCCACAAGCCAAGGGATGTGG + Intergenic
1108309439 13:49172566-49172588 TGGCCATGAACCAAGTAATGAGG - Intronic
1108592297 13:51922789-51922811 GGGCCACAAGCCAAGGACTGTGG - Intergenic
1108936633 13:55890480-55890502 GGGCCATATGCAAAAGAAAGAGG + Intergenic
1109406659 13:61909113-61909135 GGGCCATGAGCCAAGGAATGTGG + Intergenic
1109601099 13:64629640-64629662 GAGTCGTGAGCCAAGGAATGTGG - Intergenic
1109711674 13:66168667-66168689 GGGCCACAAGCCAAGGAATGAGG - Intergenic
1110312466 13:74066602-74066624 AAGCCATGATCCAAACAATGAGG + Intronic
1110535518 13:76646705-76646727 AGGCCATGAGCCAAGGAATATGG - Intergenic
1110652339 13:77956759-77956781 AGGCCATGAGCCAAGGAATGTGG - Intergenic
1110678758 13:78283005-78283027 GGTCCAAGAGACATAGAATGAGG - Intergenic
1111068108 13:83124060-83124082 GGGCCATGAACCAATGAATGAGG - Intergenic
1111423032 13:88042644-88042666 AGGCTAGGAGCCAAAGAATGTGG - Intergenic
1111455993 13:88485161-88485183 GGGTCATGTGCCAAGCAATGGGG - Intergenic
1111768629 13:92567656-92567678 GGCCCAGCAGCCAAGGAATGGGG + Intronic
1112463337 13:99622032-99622054 GAGCCATGAGCCAAAGAATGTGG - Intronic
1112746737 13:102535514-102535536 GGGCCACGGGCCAAGGAATGTGG - Intergenic
1113043938 13:106133732-106133754 GGGCCATGAGCCAAGTGATGCGG + Intergenic
1113283339 13:108815504-108815526 GGACCATTAACCAAGGAATGTGG + Intronic
1113330692 13:109324203-109324225 GGGTCAATAGGCAAAGAATGGGG + Intergenic
1113387283 13:109860410-109860432 TGGCCATGAGCTGAGGAATGAGG - Intergenic
1114183878 14:20385855-20385877 TGGCCATGAGCAAAAGTAAGAGG - Intronic
1114498219 14:23148716-23148738 GGGCCATGAGCCAAAGAATGTGG + Intronic
1114662495 14:24356381-24356403 AGGCCATGAGTCAAGGAATGTGG - Intergenic
1114736820 14:25050344-25050366 GGGCCCTGAGCCAAAGACCCGGG + Intergenic
1115162562 14:30412308-30412330 GGGCCATAAGCCAAGAAATATGG - Intergenic
1115227484 14:31119055-31119077 GAGCAGTGAGCCAAGGAATGTGG - Intronic
1115906876 14:38210605-38210627 GGGCCCTGAGCCAAAAGAGGGGG + Exonic
1116970163 14:51055603-51055625 AGGCTATGAGCCAAGGAATGTGG + Intronic
1117420519 14:55540331-55540353 GAGGCATGAACCAAGGAATGTGG + Intergenic
1117456912 14:55907113-55907135 TGGCCATGAGCCAAAGGATGTGG - Intergenic
1117778238 14:59204363-59204385 GGGCCATGTGGAACAGAATGTGG - Intronic
1117858036 14:60056000-60056022 GAGCCATGAGCCAAAGAATGCGG - Intronic
1118041241 14:61919524-61919546 AGGCCATGAGCCAAGGAAGGTGG - Intergenic
1118150386 14:63182724-63182746 AGGCTACAAGCCAAAGAATGGGG - Intergenic
1118711740 14:68525192-68525214 GGGCCATAAGCCGAGGACTGAGG + Intronic
1118717618 14:68571448-68571470 GGGCCATGAGTCAAGGAATGTGG - Intronic
1118759644 14:68872276-68872298 AGGCCACAAGCCAATGAATGCGG - Intergenic
1119847341 14:77840367-77840389 GGACCATGAGCCAAGGAATGTGG - Intronic
1119946001 14:78695103-78695125 GGGCCACAAGCCAAGGAATATGG - Intronic
1120758421 14:88265388-88265410 CAGCCATGAGCCCAGGAATGTGG + Intronic
1121066194 14:90968172-90968194 GGACCAGAAGCCAAGGAATGTGG - Intronic
1121119978 14:91370522-91370544 AGCCCCTGAGCCAAAGAAGGGGG + Intronic
1121290778 14:92773245-92773267 AGGCCATGAGCTGAAGAATGGGG - Intergenic
1121337682 14:93087213-93087235 TGGCCACAAGCCAAGGAATGTGG - Intronic
1121467036 14:94122547-94122569 GTGCCATGTGCCAAGGCATGGGG - Intergenic
1121576080 14:94989367-94989389 GGGCACTGAGCCAAATACTGGGG - Intergenic
1121660463 14:95631540-95631562 GGGCCATGAGCCAAGGAATGTGG + Intergenic
1121846798 14:97179330-97179352 GGGCCATGAGCCAAGGAATATGG - Intergenic
1121926842 14:97934735-97934757 GGTCCATGAGCCAAGGGATGTGG + Intronic
1122181553 14:99958717-99958739 GGGCCACGAGCCCAAGAATATGG + Intergenic
1122362063 14:101173447-101173469 AGGCCACTAGCCAAGGAATGTGG - Intergenic
1202884158 14_KI270722v1_random:88367-88389 GGGACATGATCTAAAGAAGGAGG - Intergenic
1123453036 15:20385379-20385401 GGGGCAGGAGCCAAGGAATGAGG + Intergenic
1123937628 15:25201720-25201742 GGGCCATGAGCCAGACCATAGGG + Intergenic
1123939166 15:25208477-25208499 GGGCCATGAGCCAGGCCATGTGG + Intergenic
1123943808 15:25229359-25229381 GGGTCATGAGCCAGACCATGGGG + Intergenic
1123944980 15:25234644-25234666 GGGCCATGAGCCAGGCCATGTGG + Intergenic
1124123088 15:26909180-26909202 GGACCATGAACCAAGGAATCTGG - Intronic
1124694683 15:31854194-31854216 GGTCCATAAGCCAAAGAATGAGG - Intronic
1124806061 15:32884321-32884343 GGGCCGTGAGCCAAGGAATGTGG - Intronic
1125037209 15:35138940-35138962 GGACCCTGAGCCAAGGAATGTGG + Intergenic
1125057507 15:35379084-35379106 GAGCCATGAGCCAAGAAATGTGG - Intronic
1125134447 15:36325488-36325510 GGGTCATGAGTCGAAGAAAGTGG + Intergenic
1125304002 15:38289714-38289736 GAGCCATGAGCCAAGGAATGTGG + Intronic
1125514526 15:40310310-40310332 GAGCCTTGGGCCATAGAATGTGG + Intergenic
1126262849 15:46714526-46714548 GGGCCATGAGCTAAGGAATGTGG - Intergenic
1126373662 15:47972916-47972938 AGGCCATGAACCAAAGAATGTGG + Intergenic
1126564888 15:50084761-50084783 GGGCCATGAGCCAAGGGACGTGG - Intronic
1126683456 15:51226239-51226261 GGGCCACAAGCCAAGGAATGTGG + Intronic
1126739161 15:51760360-51760382 GGGCCATGAGCCAAGGGATGTGG - Intronic
1127057840 15:55150672-55150694 GGGCCAGGAACCAAGGGATGTGG + Intergenic
1127259313 15:57316784-57316806 GGGAGATGAGCCAAGGACTGGGG - Intergenic
1127881205 15:63159818-63159840 GGGCCATGAGCCAAGGAATGTGG + Intergenic
1127892810 15:63270108-63270130 GAGCCATGAGCCAAGGAATGTGG + Intergenic
1128108072 15:65058848-65058870 GGGCCCAGAGCCAAAGACTCTGG + Intronic
1128832047 15:70778433-70778455 GAGCCATGAGCCAAGGAACGAGG - Intergenic
1129062721 15:72873194-72873216 GGGGCATGAGCCAAGGAAGCAGG + Intergenic
1129203480 15:74020786-74020808 GGGCCATGCACCAAGGAATGTGG - Intronic
1129326558 15:74802987-74803009 GGGACATGGGACACAGAATGGGG - Exonic
1129914244 15:79254380-79254402 TAGCCAGGAGCCAAAGAATGTGG + Intergenic
1129974146 15:79807357-79807379 GGGCCACAAGCCAAAGAATTTGG - Intergenic
1130854309 15:87827443-87827465 GGGACATGTGCCACAGAATATGG - Intergenic
1131119983 15:89815954-89815976 GGGCCACCAGCCAAGGAATGTGG - Intergenic
1131396223 15:92088674-92088696 TGGCCATGAGCCAAAGCTTGTGG - Intronic
1131652894 15:94421567-94421589 GGCCCATGAGCCAAGGGATGTGG - Intronic
1132155007 15:99489496-99489518 ATGCCATGAGCCAGAGAATGAGG - Intergenic
1132407627 15:101553687-101553709 GGGCCAGGAGCCAAGGAATGAGG - Intergenic
1133364115 16:5197461-5197483 GGACCATGAGCCAAGGAATGTGG + Intergenic
1133400477 16:5482668-5482690 GGGGCATGAGGCAGAGAATGGGG + Intergenic
1133508337 16:6433735-6433757 GGACCATGAGCCAAGGAAAGTGG - Intronic
1133556292 16:6909225-6909247 GGGCCATGAGCCATGTAATCTGG - Intronic
1133660290 16:7909846-7909868 AGGCCAGGAGCCAAGGAATGAGG + Intergenic
1133700316 16:8302450-8302472 GGGCCCTGAGCCAAAAAATCGGG - Intergenic
1133832120 16:9332961-9332983 GGGCCATGAGCCAAGGAATGTGG - Intergenic
1133918746 16:10132968-10132990 TGGCCATGAGCTAAGGAATGTGG - Intronic
1133973178 16:10581138-10581160 GTACCATGAGCCAAACATTGTGG - Intergenic
1134392314 16:13831127-13831149 GGGCCAGGAGATAAAGAAGGAGG - Intergenic
1134864114 16:17589719-17589741 TAGCCATGAGCCAAGGATTGAGG + Intergenic
1134905841 16:17978810-17978832 AGGCTATGAGCCAAGGAATGTGG + Intergenic
1135138926 16:19905442-19905464 GGACCATGAGCCAAGGTGTGCGG + Intergenic
1135208079 16:20499517-20499539 GGGCCATGAGCCAGGCAAGGTGG + Intergenic
1135210820 16:20524183-20524205 GGGCCATGAGCCAGGCAAGGTGG - Intergenic
1135653474 16:24227232-24227254 GGGCCATGAGCTAAGGAAGCAGG - Intergenic
1135913639 16:26583469-26583491 GGGCCATGAGCCAAGGAAACAGG - Intergenic
1136636281 16:31525615-31525637 GGACCAGGAGTGAAAGAATGTGG + Intergenic
1136638141 16:31538896-31538918 GGACCAGGAGTGAAAGAATGTGG - Intergenic
1136666595 16:31818268-31818290 GGACCAGGAGTGAAAGAATGTGG + Intergenic
1137262983 16:46846093-46846115 GGTCCATGAGGCAAGGGATGAGG - Intergenic
1137502990 16:49025589-49025611 GGCCCACGAGCCCAGGAATGTGG - Intergenic
1137992734 16:53176221-53176243 GTGCCACAAGCCACAGAATGTGG - Intronic
1138717030 16:59035494-59035516 GGGCCATGAGCCAAGGAATATGG - Intergenic
1139154819 16:64427938-64427960 AGACCATGAGTCAAAGAATGTGG - Intergenic
1139309451 16:66016171-66016193 GGGCCATGAACCAAGGAATGGGG - Intergenic
1139353442 16:66352443-66352465 GGTCCACAAGCCAAGGAATGTGG - Intergenic
1140013741 16:71161986-71162008 GGGCCATGAGCCAAGGAATGTGG + Intronic
1140302320 16:73770280-73770302 GAACCATGAGCCAAAGAATGGGG + Intergenic
1140613968 16:76637025-76637047 AGGCCATGAATCATAGAATGTGG - Intergenic
1140642354 16:76990951-76990973 GGACCATGAGCCACAGAATGTGG - Intergenic
1140700507 16:77577149-77577171 GGGCCACAAGCCAAGAAATGTGG - Intergenic
1140787058 16:78352458-78352480 GGGCCATGAGCCAAAGGATTTGG - Intronic
1140809232 16:78561175-78561197 GGGCCAAAAGTCAAGGAATGTGG - Intronic
1141035888 16:80625267-80625289 GGGCCAGGAACCAAGGAATGTGG - Intronic
1141159273 16:81618282-81618304 TGGCCATGAGCCAAGGAATGCGG - Intronic
1141304361 16:82847405-82847427 GGGCCAGGAGTCAAGGAATGTGG - Intronic
1141317311 16:82974745-82974767 GGGCCAGGAGTCAAGGAAAGTGG + Intronic
1141364234 16:83427396-83427418 CAGCCCTGAGCCAAGGAATGTGG + Intronic
1141416222 16:83877461-83877483 GGGTCATGAGCCAAGGAATGCGG - Intergenic
1141537899 16:84695953-84695975 GTGCCACGAGCCAAGGAATGTGG - Intergenic
1141570557 16:84931089-84931111 AGACCATGAGCCAAGGGATGCGG - Intergenic
1141586735 16:85038891-85038913 GGCCCTTGAGCCCATGAATGTGG - Intronic
1141604429 16:85144840-85144862 GGGCCAGGAGCCAAGGAATTCGG - Intergenic
1141726357 16:85791725-85791747 TGGCCATGAGCCAAGGAATGCGG - Intronic
1141763435 16:86043862-86043884 GAGCCGTGAGTCAAGGAATGCGG + Intergenic
1141854680 16:86673019-86673041 GGGCCATGAGTCAAGGAATGTGG + Intergenic
1141910427 16:87054857-87054879 GGGCCATGAGCCAAAGAATGAGG + Intergenic
1141923561 16:87152644-87152666 TGGCCACGAGCCAAGGAGTGTGG - Intronic
1141941503 16:87279032-87279054 GGCCCATGAGCCAGAGGATGCGG + Intronic
1142158656 16:88545883-88545905 GTGCCATGAGCCAAGGAACGGGG + Intergenic
1142216015 16:88830314-88830336 GGGCCAGGAGCTCAGGAATGGGG + Intronic
1142335427 16:89486573-89486595 GGGCCATGTGCCATAGTTTGTGG - Intronic
1143794259 17:9323908-9323930 GAGCCCTGATCCCAAGAATGAGG + Intronic
1143809242 17:9457346-9457368 GGGCCACAAGCCAAGGAGTGTGG - Intronic
1143907760 17:10223116-10223138 GGGCCACAAGCCACAGAATGTGG - Intergenic
1143980706 17:10867173-10867195 GGGCCACAAGGCAAGGAATGTGG - Intergenic
1144237776 17:13278707-13278729 GGGTCATGAGCCAAGGAATGCGG + Intergenic
1144588775 17:16505997-16506019 GGGCCATGAGCCATGGAATTCGG - Intergenic
1144837649 17:18165405-18165427 GGGCCATGGGCCAAGGAATGCGG - Intronic
1146424345 17:32722450-32722472 GGGCCACCAGCCAAGGAATGTGG - Intronic
1146515248 17:33484001-33484023 GAGTGATGAGCCAAGGAATGAGG + Intronic
1146928085 17:36758658-36758680 TGGCCATGAGCAAGAGAAAGAGG + Intergenic
1147321455 17:39648681-39648703 TGGCCAAGAGTCAAAGAAAGGGG - Intronic
1147583840 17:41641374-41641396 CGGCCCTGAGCCAAGGAGTGCGG + Intergenic
1147796060 17:43043918-43043940 AGGCCAGGAGCCTAGGAATGTGG + Intergenic
1147886571 17:43688295-43688317 GGGCCATGAGCCAAGGAGTGCGG - Intergenic
1148034234 17:44646270-44646292 GAGGCATGATCCAAATAATGGGG - Intergenic
1148148947 17:45384814-45384836 GGGGCAGGAGGCAGAGAATGGGG + Intergenic
1148648797 17:49234891-49234913 AGGCCAAGAGTCCAAGAATGTGG + Intergenic
1148768456 17:50053223-50053245 AGGGCCTGAGCTAAAGAATGTGG - Intergenic
1149144089 17:53468905-53468927 TGGCCAGGAGCCAAGGAGTGCGG + Intergenic
1149488566 17:57065028-57065050 GAGCCATGAGCCAAGGAATATGG - Intergenic
1150417066 17:64996344-64996366 CAGCCACGAGCCAAGGAATGCGG + Intergenic
1150794600 17:68227579-68227601 CAGCCACGAGCCAAGGAATGCGG - Intergenic
1150828293 17:68495899-68495921 GGACCAGGAGCCAAGAAATGTGG - Intergenic
1150946462 17:69751544-69751566 GGGCCATGAACCAATAAATGTGG + Intergenic
1150990663 17:70254544-70254566 GGACCGTCAGCCAAGGAATGTGG + Intergenic
1151307090 17:73269998-73270020 GGGCCATGAGCCAAGGAATGCGG + Intergenic
1151517260 17:74604640-74604662 GGGCCATGAGCCAAGGAACACGG - Intergenic
1151581934 17:74984671-74984693 AGGCCATGAGCCAAGGACTATGG + Intergenic
1152329438 17:79663567-79663589 GGGCGAAGTGGCAAAGAATGAGG - Intergenic
1152539273 17:80966811-80966833 GGGCCACGAGCCAAGGAGAGTGG - Intergenic
1152800772 17:82329763-82329785 GGGCCATGAGCCGAGGGATGCGG - Intronic
1152890672 17:82880022-82880044 AGCCCATGAGCAAAGGAATGCGG - Intronic
1152970218 18:154406-154428 GAGCCAGGAGCCAAGGAATGTGG + Intergenic
1153312128 18:3687035-3687057 GGGCCAACAGCCAAGGAATGTGG + Intronic
1153592346 18:6686902-6686924 GGGCCATGAGCCAATGATTGGGG - Intergenic
1153750655 18:8226881-8226903 GGGCCACAAGCCAAGGAATGCGG - Intronic
1153902228 18:9627845-9627867 AGGCCATGAGTCACAGAAAGTGG - Intergenic
1153993650 18:10421626-10421648 GAGCCACCAGCCAAGGAATGTGG - Intergenic
1154153559 18:11926574-11926596 GGACCAAGAACCAAGGAATGTGG - Intergenic
1154248886 18:12726169-12726191 GGCCCATGAGCCAAATAATATGG - Intergenic
1154335123 18:13458857-13458879 GGGCCTCAAGCCAAGGAATGTGG + Intronic
1154472766 18:14721125-14721147 GAGCCATGAGCCAAGGAATGTGG + Intergenic
1155293331 18:24363324-24363346 GGGCTGTGAGCCAAGGAAGGTGG - Intronic
1155341025 18:24814277-24814299 GGGCCATGAACCAAAGTATGTGG - Intergenic
1155575249 18:27238616-27238638 GGGCCACCAGCCAAAGAATGTGG - Intergenic
1155761720 18:29576313-29576335 GGGCCACAAGCCAAGGAATGTGG - Intergenic
1156195804 18:34772996-34773018 GGGCCATGAGGCAAAGAATAAGG - Intronic
1156259339 18:35430138-35430160 GGGCCATGAGCTAAGGAATGTGG - Intergenic
1156417471 18:36912345-36912367 GAGCCAGGAGCCAAGGAATATGG - Intronic
1156509739 18:37626359-37626381 GGGCTATGATCCAAGAAATGTGG - Intergenic
1157085411 18:44575454-44575476 GGGTCATGAGTCAAGGAATGTGG + Intergenic
1157413163 18:47480665-47480687 GCCACATGAGGCAAAGAATGAGG + Intergenic
1157428977 18:47607847-47607869 GGGCTGTGAACCAAGGAATGTGG - Intergenic
1157870436 18:51225478-51225500 AGGCTGTGAGCCAACGAATGTGG + Intergenic
1158123765 18:54079814-54079836 GGGCCTTCAGCCACAGACTGAGG - Intergenic
1158130630 18:54148846-54148868 GAGCCATTAGCCAAGGAATGTGG + Intergenic
1158318418 18:56237401-56237423 GGGCCATGAGCCAAAAAGTGTGG + Intergenic
1158511773 18:58096835-58096857 GGCCCATAAGTCACAGAATGCGG + Intronic
1158808161 18:60999877-60999899 GAGCCATGACCCAAGGAATGTGG - Intergenic
1159200946 18:65183282-65183304 AGGCCATGAGCCAAGAAATGTGG + Intergenic
1159286626 18:66362397-66362419 GAGCCATGTGCCAGAAAATGGGG - Intergenic
1159591505 18:70340061-70340083 AGGCCCTGAGCCAAAGAATGTGG - Intronic
1159620704 18:70635150-70635172 GGGCCCTGAATCACAGAATGAGG + Intronic
1159741299 18:72174358-72174380 AGACCGTGAGCCAAAGAATGTGG - Intergenic
1159846570 18:73468109-73468131 GGACCAGAAGCCAAGGAATGTGG + Intergenic
1159975874 18:74711491-74711513 GGGCCATGAGCCAGCAAGTGTGG + Intronic
1160363681 18:78306451-78306473 GGACCAGGAGCCAAGGAGTGTGG - Intergenic
1161079713 19:2304604-2304626 GGGCCCTGAGCCAAGGGATGCGG + Intronic
1161139988 19:2641513-2641535 GGGCCCCGAGCCAAGGGATGTGG + Intronic
1161458507 19:4382115-4382137 GGGCCGTGAGCCAATGGATGTGG - Intronic
1161655287 19:5510636-5510658 GGGCCCTGAGCCAAGGGATGCGG - Intergenic
1161872078 19:6878042-6878064 GGACCATGAGCCAGGGCATGTGG + Intergenic
1161953727 19:7481657-7481679 GGGCCATGAGCCAAGGAATGTGG + Intronic
1162428737 19:10613784-10613806 TGGCCAGGAGCCAAGGAATGTGG + Intronic
1164505242 19:28854776-28854798 GGGTCGTGGGCCAAGGAATGTGG + Intergenic
1164903978 19:31951927-31951949 GGGCCATGAGTCAAAGCACAAGG + Intergenic
1165320560 19:35082526-35082548 GGGCCATGAGCCAAGGAATGTGG - Intergenic
1165602368 19:37065492-37065514 GGGCCGTGAGCCAAGGAATGTGG + Intronic
1166820534 19:45576671-45576693 GAGGCATGAGCCAAGGAATGCGG - Intronic
1167012671 19:46819198-46819220 GGGCCTTGAGCTGAGGAATGTGG + Intergenic
1167199029 19:48051161-48051183 GGGCCATGAGCCAAGGAATGCGG + Intronic
1167370524 19:49078433-49078455 CGGCCATGAGCCAAGGAATGGGG + Intergenic
1167606868 19:50485868-50485890 GGTCCAGGAGGCAGAGAATGAGG - Exonic
1167683626 19:50941721-50941743 GGGGCATGAGCCAAGGAATATGG - Intergenic
1168200211 19:54809618-54809640 GGACCAGGAGCCAAGGAATGTGG - Intronic
1168412589 19:56148960-56148982 GGGCCATGAGCCGAGGAATGCGG - Intronic
1202659575 1_KI270708v1_random:55498-55520 GGGACATGATCTAAAGAAGGAGG - Intergenic
925211459 2:2051094-2051116 GGTCCATGAGAGACAGAATGGGG - Intronic
925372592 2:3357816-3357838 AGTCCGTGAGCCAAGGAATGTGG + Intronic
925435404 2:3833064-3833086 GGCCCACAAGCCAAAGGATGTGG - Intronic
925481946 2:4285275-4285297 GGGCCATGAGCCAAGGAATGTGG + Intergenic
926056969 2:9779347-9779369 GGGCCATGAGCCAAGGACCGGGG + Intergenic
926448222 2:12970517-12970539 GGAACATGAGCCAAGGAATGTGG + Intergenic
926482276 2:13414045-13414067 GGGGCAAGAGCCAAGGACTGAGG - Intergenic
926572460 2:14544496-14544518 GGGCCATAAGCCATGGAATGTGG + Intergenic
926576347 2:14586442-14586464 GGGCCATGAGCCAAGGAAGGTGG + Intergenic
926591070 2:14740890-14740912 GAGCCATGAGCTAAGGAACGTGG + Intergenic
926665072 2:15512682-15512704 GGGCCACAAGCCAAGGAATCTGG + Intronic
926762075 2:16286974-16286996 GGGCCATGAGCCCAGCAAGGCGG + Intergenic
926763315 2:16299111-16299133 GAGCCATGAGCCAAGGAATGTGG + Intergenic
926776689 2:16430303-16430325 GGGTCATGAGCCAAGGAATGTGG + Intergenic
926935022 2:18078316-18078338 GGGTCACAAGCCAAGGAATGTGG - Intronic
927140960 2:20130485-20130507 GGGGCATGAACCAAGGAATCGGG - Intergenic
927716743 2:25358166-25358188 GAGCCACAAGCCAAGGAATGTGG + Intergenic
928416428 2:31096035-31096057 AGGCCATGAGCCAAGGAATATGG - Intronic
929094235 2:38248480-38248502 TTTCTATGAGCCAAAGAATGCGG - Intergenic
929827897 2:45323992-45324014 GGGCCGCAAGCCAAGGAATGTGG - Intergenic
930725920 2:54681333-54681355 GGGTCATGAGCCAAGGAATGTGG - Intergenic
930769246 2:55115303-55115325 GGACCAGGAGTCAAGGAATGTGG - Intergenic
930806975 2:55500603-55500625 GGACCATGAATCAAAGAATGTGG - Intergenic
931049972 2:58401751-58401773 GAGCCATGAGCCAAAAAATGTGG - Intergenic
931052917 2:58434182-58434204 GGGCTCTGAGCCAAGGAATGTGG - Intergenic
931445594 2:62324602-62324624 GGGCTATGAGCCAGGGAATGTGG - Intergenic
931456909 2:62417061-62417083 GGGCCATGAGCCAAGGCATGTGG + Intergenic
931465981 2:62487236-62487258 AGGCCATGAAACAAGGAATGTGG - Intergenic
931940419 2:67245977-67245999 TGGCCATGAACCAAAGAATGAGG + Intergenic
932368597 2:71169246-71169268 GGGCCATGAGCCAGACAACTGGG + Intergenic
932378123 2:71256207-71256229 GGGCCTAGAACCAAATAATGGGG + Intergenic
932438898 2:71719401-71719423 CAGCCAAGAGCCAAGGAATGAGG - Intergenic
932512728 2:72311402-72311424 AGGCCATGACCCAAAGAGTACGG - Intronic
932696707 2:73963040-73963062 GGGCCACAAGCCAAGGAATGTGG - Intergenic
933027574 2:77280205-77280227 GGGCCATGACCCAAGGAATGTGG + Intronic
933258949 2:80110436-80110458 GGGATATGAGGCAAAGAATGTGG - Intronic
933266688 2:80188612-80188634 GGGCTGTGAGCCAAGGAATTGGG - Intronic
933377748 2:81501753-81501775 GAGCCATAAGCCAAGGAATAAGG - Intergenic
933616627 2:84488533-84488555 CGGCCAGGAGCCAAGGAATGTGG - Intergenic
933627014 2:84612619-84612641 AGGCCATGAGCCAAGGAATGTGG - Intronic
934034074 2:88074315-88074337 GGGCCATGAGCCAAGGAATGTGG - Intronic
934509489 2:94925841-94925863 GGGCCATGAGCCAAAGAATAGGG - Intergenic
934719402 2:96562851-96562873 GAGCCACAAGCCAAGGAATGTGG + Intergenic
935280485 2:101513182-101513204 GGGTCACGAGGCAAGGAATGTGG - Intergenic
935674444 2:105582084-105582106 GGACCATGAGCCCAGCAATGTGG + Intergenic
935716002 2:105939479-105939501 GGGCCATGATCCCAAGTTTGTGG - Intergenic
936505632 2:113103484-113103506 CCGCCATGAGGCAAGGAATGTGG + Intergenic
936863462 2:117050631-117050653 GGACCATGAGCCAAGAAATGTGG - Intergenic
936872627 2:117150716-117150738 AGGACATGATTCAAAGAATGGGG + Intergenic
936924449 2:117722168-117722190 AGGACACAAGCCAAAGAATGCGG + Intergenic
937539514 2:122931350-122931372 GGCCCATAAACCAAAGAATATGG + Intergenic
937732192 2:125246647-125246669 GGGCCATGAGCTAAGGGTTGTGG - Intergenic
938785674 2:134626429-134626451 GGGCTAACAGCCAAGGAATGTGG - Intronic
938835726 2:135102265-135102287 GGGCCATGAGCCAAGTAATGAGG + Intronic
939006583 2:136795282-136795304 CAGCCATGAGCCAAGGAATGTGG - Intronic
939379231 2:141413402-141413424 AGGCCATGAGCCAAGCAATGTGG + Intronic
939509401 2:143088300-143088322 GGGCCATGAGCCAAGAAATGTGG - Intergenic
939675799 2:145070570-145070592 GAACCATCAGCCAAAGAAAGGGG - Intergenic
940202561 2:151167455-151167477 GGGGCAGGAGCAAAAGAGTGAGG + Intergenic
940224293 2:151385446-151385468 AAGCCATGAACCAAAGAACGTGG + Intergenic
940329372 2:152457846-152457868 GGGCCACAAGCCAAAGAAGGTGG - Intronic
940521924 2:154762027-154762049 GGGCCAGTAGTCAAGGAATGTGG + Intronic
940644846 2:156380567-156380589 GAGCCATGAGTGAAAGAATGTGG - Intergenic
941341430 2:164309899-164309921 GGGCCAGCAACCAAGGAATGTGG - Intergenic
941953808 2:171184143-171184165 GGGCCAAAAGCCAAGGAACGAGG + Intronic
942122198 2:172789055-172789077 GGGCCATGTGGCAAGAAATGTGG - Intronic
943070602 2:183136511-183136533 GAGCCATGAGCCAAGGAGTGAGG - Intronic
943070974 2:183140267-183140289 GGGACATAAACCAAAGAATGTGG - Intronic
943108946 2:183582164-183582186 GGGCCATAAGCCGAGGAATACGG - Intergenic
943116824 2:183683184-183683206 GGGCCATCAGTCAAAGAATGTGG + Intergenic
943120716 2:183731786-183731808 GGTTCATGAGCCAAGGAAGGCGG - Intergenic
943803574 2:192092795-192092817 GGGCTATGAACCAAGGAATGGGG + Intronic
943901192 2:193439381-193439403 GGGCCATGAGCCAAAAATGCAGG + Intergenic
944365885 2:198919167-198919189 GGGCCAGGAGCAAAATAATGTGG - Intergenic
944466689 2:200008472-200008494 AGGCCATGAGCCAAGGAGAGTGG + Intronic
944606116 2:201352901-201352923 GGTCCAGGAGCCAAGGAATCGGG + Intronic
944931917 2:204528579-204528601 GGGTCATGAGCCAAGGAATGTGG + Intergenic
945061792 2:205915797-205915819 GGGGCAGGAGCCAGGGAATGTGG - Intergenic
945180195 2:207083869-207083891 GCATCATGAGCCAAGGAATGTGG + Intronic
945230952 2:207589292-207589314 GGGCCATGAGGCAAAAAATGTGG - Intronic
945441654 2:209886990-209887012 GGGCTATAAGCCAAGAAATGTGG - Intronic
945683284 2:212938713-212938735 GGGCCCTAAGCCAAAGACTATGG + Intergenic
945750482 2:213776337-213776359 GGGCTATAAGCTAAGGAATGTGG + Intronic
945983367 2:216334258-216334280 AGGCCTTGAGCCAAGGAATGTGG + Intronic
946086565 2:217179371-217179393 TGGCCTTGAGCCAAGGAATGCGG + Intergenic
946136218 2:217649391-217649413 GGGCCCTAAGCAAAGGAATGTGG + Intronic
946367330 2:219256911-219256933 GGGCCATGAGTAAAAGAATATGG + Intronic
946448220 2:219757881-219757903 GGGCCATGAGCCATGGAAAGTGG + Intergenic
946566564 2:220972027-220972049 GAGCTATGAACCAAGGAATGTGG + Intergenic
947154385 2:227146725-227146747 GGACCAGGAGCCAAGGAATGTGG - Intronic
947258090 2:228188837-228188859 GGGCTAGGAGCCAAGAAATGCGG - Intergenic
947273861 2:228369822-228369844 CTACCATGAGCCAAAAAATGTGG + Intergenic
947435647 2:230069722-230069744 GAGCCACCAGCCAAGGAATGTGG - Intergenic
947458047 2:230274460-230274482 GGTCCATCAACTAAAGAATGTGG + Intronic
947534119 2:230930078-230930100 GGGCCAGGAGTCAAGGAATGAGG + Intronic
947923946 2:233904658-233904680 AGGCCATAAGCCAAGGAATATGG - Intergenic
947954783 2:234179289-234179311 AGGCCATGAGCCAGGGAATGTGG - Intergenic
948036940 2:234865367-234865389 GGGCCATGAGCCAAGGAAAGTGG - Intergenic
948115163 2:235490070-235490092 GGGCCACCAGCCAGGGAATGTGG - Intergenic
948121026 2:235530562-235530584 GGGCCATGAGCCAAGGAGTGTGG - Intronic
948125302 2:235560638-235560660 AGGCTACCAGCCAAAGAATGTGG + Intronic
948133458 2:235619019-235619041 GAGCCATGAGCCAAGGAATGGGG + Intronic
948324505 2:237102647-237102669 GGGGCATGAGCCAAGAAATGCGG - Intergenic
948668128 2:239548974-239548996 GAGCCACCAGCCAAGGAATGTGG - Intergenic
1169133425 20:3180448-3180470 GGGCCATGAGCCAAGAAATGTGG + Intergenic
1169524990 20:6414726-6414748 GAGCCATGAGCCAAAGAATGTGG + Intergenic
1169757266 20:9056082-9056104 GAGCCATGAGCCAAGGAGTACGG + Intergenic
1170032158 20:11955147-11955169 TGGCCAGGAGCCAAGGAATGTGG + Intergenic
1170413898 20:16120207-16120229 GGACCATGAGCTGAGGAATGTGG - Intergenic
1170536239 20:17343797-17343819 GGATCATAAGCCAAGGAATGAGG + Intronic
1170758882 20:19231540-19231562 AGGCCGTGAGCCAAGGAATGGGG + Intronic
1171063206 20:21986807-21986829 GGGTCATGAGCCAACGAATGTGG + Intergenic
1171233661 20:23507849-23507871 AGGCCATGAGGCAAGGACTGTGG + Intergenic
1171519921 20:25767907-25767929 GGACCAAGAGCCAGAGCATGAGG - Intronic
1171556998 20:26088586-26088608 GGACCAAGAGCCAGAGCATGAGG + Intergenic
1171857340 20:30359259-30359281 GTCCCATGATCCAAAGAATAGGG + Intergenic
1172181344 20:33005578-33005600 GGACCAGGAGCCAAGGAATAAGG + Intergenic
1172475889 20:35237331-35237353 GGGCCACAAGCCAAGGGATGCGG - Intronic
1172571192 20:35972163-35972185 GGCCCACAAGCCAAGGAATGTGG - Intronic
1172593278 20:36132308-36132330 GGGCCATGAACCAAGGCATGTGG - Intronic
1172671108 20:36635049-36635071 TGGCCATGAGGCTCAGAATGTGG + Intronic
1172933708 20:38603794-38603816 GGACCATCAGCCAAGGAATGTGG - Intronic
1173013586 20:39204778-39204800 GGGCCACAAGCCAAAGAATGTGG - Intergenic
1173052333 20:39575512-39575534 GGGCCACAAGCCAAGGGATGTGG + Intergenic
1173105541 20:40130009-40130031 TGGCCACAAGCCAAGGAATGTGG + Intergenic
1173153599 20:40588797-40588819 GGGCTGTGAGCCAAGGAATGTGG - Intergenic
1173320764 20:41985025-41985047 GGGCCATGAGCCAAGGAATGTGG + Intergenic
1173565207 20:44033646-44033668 GGGCCACAAGCCAAGGCATGAGG + Intronic
1173914626 20:46697818-46697840 GGGCTATCAGACAAGGAATGTGG - Intergenic
1174098240 20:48106609-48106631 GGGCCATGAGCCAAGGAATGTGG + Intergenic
1174605977 20:51761948-51761970 GGGCCATGAGCCAAGGAATGCGG - Intronic
1174703880 20:52636278-52636300 AGGCCATGAGTCAAGGAATGTGG + Intergenic
1174839858 20:53891565-53891587 AGGCCATGAGCCAAGGAATGTGG - Intergenic
1175021844 20:55859378-55859400 GGGCCACAAGCCAAGAAATGTGG + Intergenic
1175172516 20:57090466-57090488 GGGCCACAGGCCAAGGAATGTGG + Intergenic
1175320184 20:58080030-58080052 GGGCCATGAGCCAAGGAAAGCGG - Intergenic
1175458910 20:59136139-59136161 GGGCCATGAGCCAAGGAATGAGG - Intergenic
1175571542 20:60026522-60026544 GGGCCACAAGCCAAGGAATGTGG + Intronic
1176049022 20:63106874-63106896 GGGCCACAAGCCAAGGGATGCGG + Intergenic
1176187795 20:63790868-63790890 GGGCCATGGGGCACAGAGTGCGG + Exonic
1176272209 20:64241247-64241269 CGGCCATGACCCGGAGAATGTGG - Exonic
1176801722 21:13436730-13436752 GAGCCATGAGCCAAGGAATGTGG - Intergenic
1177218486 21:18159860-18159882 GGACCATGAGCCAAGGACTGTGG + Intronic
1177318413 21:19491054-19491076 AGGCCATGAGCCAAGAAATGTGG - Intergenic
1177394932 21:20521720-20521742 GAGCCATAAGCCAAGGGATGTGG - Intergenic
1177441466 21:21132101-21132123 AGGCCATGAGCAAATGCATGCGG - Intronic
1177773863 21:25546493-25546515 GGGCCACAAGCCAAGGAAGGCGG - Intergenic
1177881906 21:26704285-26704307 GGCCCATGAGCCATGGAATGGGG - Intergenic
1177890494 21:26798629-26798651 GGGCCGTGAGTCAAGGAATGTGG - Intergenic
1178120047 21:29460443-29460465 TGGCCATGAGCCAAAGAAACTGG + Intronic
1178139079 21:29661507-29661529 GGGCCACAAGACAAGGAATGAGG + Intronic
1178249564 21:30989356-30989378 GGGCCATGGGGCAAAGAAGCAGG - Intergenic
1178401836 21:32293175-32293197 GGGCCATGAACCAAGGAATGAGG + Intronic
1178642427 21:34355861-34355883 GGGCCAAGAGCCAAAGAATGTGG + Intergenic
1178665562 21:34543387-34543409 GGGCCATGAGCCAAGGAAAGTGG + Intronic
1178804105 21:35824184-35824206 GGGCCATGAGTCAAGGAATGTGG + Intronic
1179034477 21:37747710-37747732 GGGCCATGAGACAAGGATTGTGG + Intronic
1179169457 21:38961782-38961804 GGGCCATGAGCCAAGGAACGTGG - Intergenic
1179517689 21:41920022-41920044 GCACCCTGAGCCAAAAAATGGGG + Intronic
1180327044 22:11439059-11439081 GGGACATGATCTAAAGAAGGAGG - Intergenic
1180378683 22:12117886-12117908 GGGACATGATCTAAAGAAGGAGG - Intergenic
1181833083 22:25578690-25578712 GGGCCATGGACCGAGGAATGTGG + Intronic
1182000988 22:26919641-26919663 GGGCCAAGAGCTAAGGAATGAGG + Intergenic
1182273996 22:29173048-29173070 GGGCCACGAGCCAAGACATGGGG + Intergenic
1182711634 22:32326893-32326915 GGGCCAAAAGCCAAGGAATGTGG + Intergenic
1182809472 22:33103607-33103629 GGACCATGTGGCAAGGAATGTGG + Intergenic
1183984250 22:41560906-41560928 GGGCCATGAGCCACAGAGCCTGG + Exonic
1184337928 22:43865830-43865852 AGACCATGAGCTAGAGAATGTGG - Intergenic
1184399168 22:44263710-44263732 GGGCCACAAGCCGAGGAATGTGG + Intronic
1184473632 22:44709430-44709452 GGGCCCCAAGCCAAAGAATGTGG + Intronic
1184534011 22:45074105-45074127 GGGCCATAAGCCAAGGAATGGGG - Intergenic
1184618059 22:45651598-45651620 AAGCCATGAGCCAAGGAGTGTGG + Intergenic
949092250 3:42101-42123 GAGCCATGAGCCAAGGAATGTGG - Intergenic
949335010 3:2965191-2965213 CTGCAATGAGACAAAGAATGTGG - Intronic
949357506 3:3197610-3197632 AGGCCATGAACCAAAGAATCTGG - Intergenic
949401393 3:3668658-3668680 GGTTTATGAGCCCAAGAATGTGG - Intergenic
949438564 3:4055914-4055936 TGGTCAAGAGCCAAGGAATGTGG - Intronic
949773569 3:7605958-7605980 GGCCCATCAGCCAAATAATAAGG - Intronic
950741595 3:15056618-15056640 AGGCCACAAGCCAAAAAATGTGG + Intronic
950882545 3:16334953-16334975 GGGCCACGAGCCAAGGAACATGG + Intronic
950962516 3:17120598-17120620 GGTCCATGAGCTAGAGAGTGAGG - Intergenic
951678196 3:25265924-25265946 GGGCCATGAGCCAATGAATGTGG - Intronic
951858076 3:27220334-27220356 GAGCCATAAGCCAAGGAATGTGG - Intronic
951994107 3:28707776-28707798 GGGCCATGAACCAAAGACCATGG - Intergenic
952039100 3:29240384-29240406 GAGGCATGAGCTAAGGAATGTGG - Intergenic
952491013 3:33872733-33872755 GGGCCATGAGCCACAGAAAGTGG + Intergenic
952518402 3:34129266-34129288 GGTCCATGAGCCACAGAATGTGG - Intergenic
953028332 3:39158608-39158630 GGGCCCTTAGCCTCAGAATGAGG - Intergenic
953931629 3:47008676-47008698 GGGCCATGAACCCATAAATGGGG - Intronic
953953841 3:47214948-47214970 GGCCTATGAGCCAAGGGATGTGG + Intergenic
954796783 3:53165527-53165549 GGCTCATGGGCCAAAGATTGAGG + Intronic
955413753 3:58673250-58673272 GAGCCATGAGCCAAGGAGAGTGG - Intergenic
956106896 3:65828903-65828925 GGGCCATGAGTCATGGAATGTGG + Intronic
956374031 3:68594991-68595013 GGGCCATGAGTGAAGGGATGTGG - Intergenic
956515818 3:70046815-70046837 GGGCCACCAGACAAAGAATGTGG - Intergenic
956876401 3:73468230-73468252 CGACCATGAGCCAAGAAATGTGG + Intronic
957032514 3:75258056-75258078 GAGCCATGAGCCAAGGAATGTGG - Intergenic
957094678 3:75767786-75767808 GGGACATGATCTAAAGAAGGAGG + Intronic
957118788 3:76061882-76061904 GGACCACAGGCCAAAGAATGCGG - Intronic
957265059 3:77952858-77952880 GGGCCATGAGCCTAGGAATGTGG - Intergenic
957777958 3:84779562-84779584 GGACCAGGAGCCAGAGAATAGGG - Intergenic
958009915 3:87863980-87864002 GTGGCATGAGTCAAGGAATGTGG - Intergenic
958610850 3:96424309-96424331 TGGCCATGACCCACAGAAGGCGG - Intergenic
958853802 3:99360191-99360213 GGCCCATGAGCCAAGGAATGTGG + Intergenic
958977334 3:100682601-100682623 GGGCCATGAGCCAGGCAAGGGGG + Intronic
959029523 3:101281838-101281860 GGGCCATGAGCCAAGAAATGTGG + Intronic
959094498 3:101938983-101939005 GTCACATGAGGCAAAGAATGTGG - Intergenic
959099816 3:101997491-101997513 GGGCCAGGAGCCAAGGAAGGTGG + Intergenic
959585797 3:108023975-108023997 GGGCCGTGAGCCAAGGAACGTGG + Intergenic
959590624 3:108075917-108075939 GGGCCATGGGGCAAGAAATGAGG + Intronic
959687077 3:109159127-109159149 GGGCCACAAGCCAAGGAATGCGG - Intergenic
959765796 3:110026166-110026188 TGGACATGAGTCAAGGAATGTGG + Intergenic
960194080 3:114743585-114743607 GGGCAGTGATCCAAAAAATGTGG + Intronic
960584866 3:119311332-119311354 GTGACATGAGTCAAGGAATGAGG - Intronic
960928210 3:122817296-122817318 GGGCCCTGAGCCAACGAATGCGG + Intronic
961425637 3:126844904-126844926 AGGCCATGAGCCAAGGAATGGGG + Intronic
961442791 3:126962703-126962725 GGGCCATGAGCCAGACATGGAGG - Intergenic
961473558 3:127133598-127133620 GGGCCACGAGCCAAGGATGGAGG - Intergenic
962274905 3:134004734-134004756 GGGCCACAAGCCAAGGAATGTGG + Intronic
962444872 3:135455311-135455333 GGGCCACAAGTCAAGGAATGCGG - Intergenic
962889996 3:139663167-139663189 GAGGCAGGAGCCACAGAATGTGG - Intronic
963002406 3:140694784-140694806 GGGGCATGAGGCAAGGAATGCGG - Intronic
963075685 3:141344325-141344347 AAGCCATGAGCCAAGGAATCAGG - Intronic
963353761 3:144184639-144184661 GGGCCACAAACCAAGGAATGAGG + Intergenic
963438552 3:145306053-145306075 GGACCATGAGTCAAGAAATGTGG - Intergenic
963640576 3:147857450-147857472 GGACCAAGAGAGAAAGAATGAGG + Intergenic
963665498 3:148180690-148180712 GGGCCATAAGCCCAGGAACGTGG - Intergenic
963918846 3:150886691-150886713 GGGCCACTAGCCAAGGAATGAGG - Intronic
963919176 3:150889302-150889324 GAGCCATGAACCAAGGAATGTGG - Intronic
963977295 3:151495730-151495752 GGAACATGAGCCAAATATTGAGG + Intergenic
964116972 3:153146791-153146813 GGGCCATGTGACGAAGAATTTGG - Intergenic
964367966 3:155969902-155969924 GGGCAACAAGCCAAGGAATGCGG - Intergenic
964539298 3:157761511-157761533 GGATCATGAGACAAAGAATATGG + Intergenic
964615869 3:158664496-158664518 GGGCCACAAGCCAAGGAAGGTGG - Intronic
964654911 3:159055579-159055601 GGGCCACCAGCCACAGAATGTGG - Intronic
964743685 3:159991781-159991803 GGGCCACAAGTCAAGGAATGTGG - Intronic
964813524 3:160691972-160691994 GGGCCATGAGCCAAGGAATGTGG + Intergenic
964862702 3:161220090-161220112 GGACCACAAGCCAAGGAATGTGG + Intronic
965422564 3:168480332-168480354 GGTACAAGAGCCAAGGAATGTGG - Intergenic
965537914 3:169843234-169843256 GGGCCATGTATCAAGGAATGTGG + Intronic
965555932 3:170018445-170018467 GGGCCATGAGCCAGAGGAGGCGG - Intergenic
966323437 3:178727648-178727670 GAGTCATGAGCCAAAAAAAGTGG + Intronic
966562643 3:181340800-181340822 AGGCCACAAGCCAAGGAATGTGG + Intergenic
967310686 3:188103414-188103436 GGGCCAGAAGCCAAGAAATGGGG + Intergenic
967346933 3:188467750-188467772 GGGCCACAAGCCAAAGAATGAGG + Intronic
967369730 3:188730848-188730870 GGGCCACAAGTCAAGGAATGTGG - Intronic
967504954 3:190243589-190243611 GGGGCAAGAGAGAAAGAATGAGG + Intergenic
967552734 3:190817330-190817352 GAGACATGAGCCAAGAAATGTGG + Intergenic
968024403 3:195427152-195427174 GGGCCATGAGCCAAGGAATATGG + Intronic
968880470 4:3296120-3296142 GAGCCGGGAGCCAAGGAATGAGG - Intronic
969072801 4:4552924-4552946 GGGCCGTGAACCAAAGAACGTGG - Intergenic
969143307 4:5099116-5099138 AGGTCATGAGCCAGGGAATGTGG - Intronic
969222631 4:5771285-5771307 GGGCCCTGAGCCAAGGAATGTGG - Intronic
969240959 4:5897211-5897233 GGGCCACAAGCCAAAGAATGTGG + Intergenic
969302635 4:6306189-6306211 GGGCCATGAGCCAAGGAATGTGG + Intergenic
969342718 4:6552413-6552435 GGGTCATGAGCCAAGGAATGCGG - Intronic
969431408 4:7156955-7156977 GGGCCAGGGGCCCAGGAATGTGG + Intergenic
969588448 4:8107941-8107963 GGGCCACAAGCCAAGGAATGTGG + Intronic
969695474 4:8731808-8731830 GGGCCACGAGCCAATGAATGTGG + Intergenic
969939137 4:10712973-10712995 GGGCAATGGGCCAGGGAATGGGG - Intergenic
970052423 4:11929700-11929722 TGGCCCTCAGCCAAAGAATAGGG + Intergenic
970141058 4:12982744-12982766 GGACCATGAGGCAAGAAATGAGG - Intergenic
970224076 4:13839048-13839070 GGGCCATGAGCCAAGGATACAGG - Intergenic
970949975 4:21743305-21743327 GGGCCATGAGCCAAGGAATGTGG - Intronic
970997672 4:22286089-22286111 GGGCCATGAGTCAAACAACGTGG - Intergenic
971065382 4:23026463-23026485 TGCCCATGAGCCAATCAATGTGG + Intergenic
971260986 4:25057015-25057037 GGGCCAGAAGCCCAGGAATGTGG - Intergenic
971574116 4:28252273-28252295 GGCCCATAAGCCAAGGAATGAGG - Intergenic
971778216 4:30995756-30995778 GGGCCACTAGCAAAGGAATGTGG - Intronic
971960228 4:33477071-33477093 TGGCCATGAACCAAGGAATGTGG - Intergenic
972297870 4:37757335-37757357 GGGCCCTAAACCACAGAATGCGG + Intergenic
972838245 4:42901434-42901456 GGGCCACAAGCCAAGGAATGTGG - Intronic
972842569 4:42948813-42948835 GGACCATTATCCACAGAATGGGG + Intronic
972967072 4:44523837-44523859 GGGCCATCAACCAAGGAATATGG + Intergenic
973026696 4:45282761-45282783 GGGGCATGAACCAAGGAACGTGG + Intergenic
973075635 4:45922354-45922376 GGGCCTCAAGCCAAAAAATGAGG + Intergenic
973530291 4:51831072-51831094 GAGCCAAGAGCCAAGGAACGTGG - Intergenic
973684284 4:53354080-53354102 GGCCCAAGGGCCGAAGAATGTGG - Intronic
973903036 4:55497222-55497244 GAGCTATGAGCTAAAGAATACGG - Intronic
974080629 4:57208711-57208733 GGGCCATGAGCCAAGGAATGTGG + Intergenic
974089074 4:57291728-57291750 GGGCCATGAGGTTGAGAATGGGG + Intergenic
974420608 4:61668245-61668267 GGGCCACAAGCCGAAGAATGAGG + Intronic
974840517 4:67294482-67294504 GGGCCATGAGCCAAGGATTGCGG - Intergenic
974909314 4:68097369-68097391 GGACCATCAGCAAAGGAATGAGG - Intronic
975543498 4:75537820-75537842 TAGCCATGAGCTAAGGAATGTGG + Intronic
975566145 4:75756280-75756302 GAGCCGTGAGCCAGAGAATGTGG + Intronic
975634968 4:76439165-76439187 GGACCATGAGCCAGGGAATGTGG - Intronic
975785206 4:77880279-77880301 GGGCCATGAGCTAAAGAATGTGG - Intronic
975887491 4:78982704-78982726 GGGCCATGATTCAAGGAGTGTGG + Intergenic
975904839 4:79196908-79196930 GGGCCATGAACCAGGGAATGTGG + Intergenic
976037047 4:80836466-80836488 GGGCCATGAACCAAAGAATGTGG - Intronic
976782636 4:88778021-88778043 AGGCCTTGAGGCAGAGAATGGGG - Intronic
976848061 4:89512621-89512643 GGGCCAGGAGCCAAGAAAGGAGG + Intergenic
977133688 4:93273737-93273759 GGGCCATGAGTGAAGAAATGTGG + Intronic
977494747 4:97760922-97760944 GGGCCAGTAGCCCAGGAATGTGG - Intronic
977535527 4:98252572-98252594 GGGCCACAAACCAAGGAATGAGG + Intergenic
978103779 4:104876295-104876317 AGGCCATGAACCAAGGAATGTGG + Intergenic
978143236 4:105341581-105341603 GAGCTGTGAGCCAAGGAATGTGG - Intergenic
978505070 4:109447941-109447963 GGGCCATGGACCAAGGAATGTGG - Intronic
978753286 4:112276253-112276275 AGGTCATGAGCCAAGGAATGTGG - Exonic
979257992 4:118624366-118624388 GGGCCATGATCCAAGGAATGGGG + Intergenic
979330357 4:119416197-119416219 GGGCCATGATCCAAGGAATGGGG - Intergenic
979448363 4:120840298-120840320 GGGCCCTGAGCCAAATGACGGGG - Intronic
979559245 4:122083531-122083553 GGGCCATGAGCCAAGGACAGTGG + Intergenic
979672627 4:123376898-123376920 TGGCCATGAGTAAAGGAATGAGG - Intergenic
980082320 4:128357205-128357227 GGGCCATGAGCCAAGGAGTGTGG + Intergenic
980082778 4:128362092-128362114 GGGTCGTGAGCCAAGGAATAAGG + Intergenic
980206591 4:129726945-129726967 GGGTCATGAGCCGAGGAAGGTGG - Intergenic
980251338 4:130319670-130319692 GGACCACGAGCCAAAAATTGAGG + Intergenic
980849696 4:138365945-138365967 GGACCATGAGCCAAGGAATGTGG + Intergenic
981402439 4:144329149-144329171 GGACCATGAGCCAAGGAATGAGG + Intergenic
981420973 4:144549953-144549975 GGGCCATGAGCCAAAAAATGTGG + Intergenic
981517723 4:145628458-145628480 GGGCCATGAACCAAGGAATGAGG - Intronic
981701368 4:147610560-147610582 TGACCATGAACCAAAGAGTGTGG + Intergenic
981759049 4:148173475-148173497 GGGCCACGAGCCAAAGAATGTGG + Intronic
982276933 4:153645407-153645429 AGGCCACAAGCCAAGGAATGTGG - Intergenic
982317617 4:154047418-154047440 GGGCCAGAAGCTAAAGAATGCGG + Intergenic
982525984 4:156478797-156478819 GGGCCAGGAGCTAACGAATGAGG + Intergenic
982831229 4:160063155-160063177 GGGCCATGAGACAAAGAACATGG - Intergenic
983815389 4:172120410-172120432 AGGCCCTGAGTAAAAGAATGAGG - Intronic
984052092 4:174876877-174876899 AGGCCATGTGCCAAGGAAAGTGG - Intronic
984113479 4:175648693-175648715 GGGCCAAGAGCCAAGGCATGTGG - Intronic
984629777 4:182049268-182049290 AGGCCTTTATCCAAAGAATGAGG + Intergenic
985116174 4:186593671-186593693 AAACCAAGAGCCAAAGAATGTGG + Intronic
985295026 4:188427712-188427734 GGGCCAAAAGCCACAGAATATGG + Intergenic
1202760300 4_GL000008v2_random:103356-103378 GGGACATGATCTAAAGAAGGAGG - Intergenic
986180281 5:5386586-5386608 GGTCCATGTGGCAAGGAATGTGG + Intergenic
986396405 5:7335090-7335112 GGGCCAAGAGCCAAGGAATGAGG + Intergenic
986645292 5:9910947-9910969 GGGCCATGGCCCAAAGAACGTGG - Intergenic
986681915 5:10241138-10241160 GGGTCAAGAGCCTAGGAATGTGG - Intronic
986747222 5:10755225-10755247 GCGCCACGAGCCAAGGAAAGTGG + Intronic
986794164 5:11192643-11192665 GGGTCATGAGCCAAAGAATGTGG + Intronic
986855657 5:11865853-11865875 GAGCCACAAGCCAAGGAATGTGG + Intronic
987228461 5:15868135-15868157 GGACCATGGGCCAAGGAATGTGG + Intronic
987651167 5:20741754-20741776 GGATCATGACCCAAAGAATCTGG + Intergenic
987721334 5:21636651-21636673 AGGCCATGAGAAAAGGAATGTGG - Intergenic
987985434 5:25140193-25140215 GGGCCACCAGCCAAGGAATGAGG + Intergenic
988744396 5:34119695-34119717 GGATCATGACCCAAAGAATCTGG - Intronic
988999121 5:36742864-36742886 GGCCCATAAGCCGAAGAATCTGG + Intergenic
989136076 5:38156335-38156357 GGGCCATGAGCCAGGAAATACGG - Intergenic
989344301 5:40411888-40411910 GGACCATGAGGAAAGGAATGTGG + Intergenic
989511395 5:42291842-42291864 TGGCCATGAGCCAAGGAATGCGG + Intergenic
989708870 5:44372233-44372255 AGGCCATGAGCCAAGGAATGTGG - Intronic
989803864 5:45580366-45580388 GGGTCACAAGCCAAGGAATGTGG + Intronic
989987106 5:50713867-50713889 GAACCATGAGGCAAGGAATGTGG + Intronic
990089375 5:52022936-52022958 AGGACATGAGCCAAAGAATGTGG - Intronic
990214535 5:53515463-53515485 GGGCCATGTGGCAATGAATGGGG - Intergenic
990592597 5:57281531-57281553 GGGCCATGAGCCAAGGAATGGGG + Intergenic
990795149 5:59531635-59531657 GGGCCTGGAGCCAAGGAATGTGG - Intronic
990865335 5:60373799-60373821 GGGCCATGAGCCAAGGAATAAGG - Intronic
990867082 5:60391528-60391550 GGGCCACAAGCCACAGAATGTGG - Intronic
991074519 5:62519949-62519971 GGGCTATGTGTCAAAGAATGTGG - Intronic
991221353 5:64223180-64223202 GGGCCACAAGCCAAGAAATGAGG - Intronic
991259918 5:64655778-64655800 GGGCCATGTGTCAAGGAATGTGG - Intergenic
991608214 5:68424249-68424271 AGGCCATGAACCAAAGAGTGTGG - Intergenic
991966417 5:72095999-72096021 GGGCCATGGGCCAAGGAATGTGG - Intergenic
992571176 5:78059226-78059248 GAGCCATGAACCAAGGAATGTGG + Intronic
992751802 5:79869314-79869336 GAGCCATGAGCCAAGGAATGTGG - Intergenic
993250614 5:85516471-85516493 AGGCCACAAGCCAAGGAATGAGG + Intergenic
993382410 5:87222752-87222774 GACCCATGAGCCAAAGAATGTGG + Intergenic
993986877 5:94607857-94607879 GGGCCACAAGTCAAGGAATGAGG - Intronic
994048277 5:95333253-95333275 GGGCCATGAATGAAAGAATGTGG + Intergenic
994199691 5:96958726-96958748 GGGCCAGGAGCCAAGGAATGTGG - Intronic
994503087 5:100605107-100605129 GCCCCAAGAGCCAAAAAATGTGG - Intergenic
994504210 5:100619916-100619938 GGACCATAAGCCAAAAAATGCGG + Intergenic
994549553 5:101213357-101213379 GGGCCTTTAGCCACAGACTGAGG + Intergenic
994774083 5:104022259-104022281 TGGCCATGAGCCAAGGAATTTGG - Intergenic
995201558 5:109430397-109430419 GTACCATGAACCAAGGAATGTGG + Intergenic
995272319 5:110235735-110235757 TGGTCATGAGCCAAGGAATTGGG - Intergenic
995437785 5:112157568-112157590 GGGCCACAAGCCAAAGAATATGG - Intronic
995702994 5:114956363-114956385 GGGCCACAACCCAAGGAATGTGG + Intergenic
995808880 5:116083258-116083280 GGGAAATGATTCAAAGAATGAGG + Intergenic
995913094 5:117211668-117211690 GGACCAAGAGGCAGAGAATGTGG + Intergenic
996058065 5:119001959-119001981 GGGCCATAAGCCAGAGAACATGG - Intergenic
996206385 5:120742877-120742899 GGGCCATGAGCTAAGTTATGTGG - Intergenic
996389883 5:122948430-122948452 GGCCCATGAACCTAAGAAAGTGG + Intronic
996624754 5:125557290-125557312 GAGCCACAAACCAAAGAATGTGG - Intergenic
996816897 5:127584090-127584112 GAACCATGAGCCAAAGGCTGTGG + Intergenic
997319928 5:132969579-132969601 GGGTCACAAGCCAATGAATGAGG - Intergenic
997902230 5:137777647-137777669 GGGCCATGAGCCAAGGAAGGTGG - Intergenic
997927917 5:138047768-138047790 AGGCCATGAACCAGGGAATGTGG + Intronic
998357449 5:141552478-141552500 GGACCATAAGCCAAGGAATCTGG + Intronic
998600452 5:143579867-143579889 GGGCAATGAGCCAAGGAATACGG - Intergenic
998878696 5:146625954-146625976 GGGCCATTAGCCATGGAATGTGG + Intronic
999005577 5:147973754-147973776 GGGCCATGAGTCAAGGAAAGTGG - Intergenic
999194005 5:149769791-149769813 GGGCCACAAGCCAAGGAATGTGG - Intronic
1000305213 5:159988222-159988244 AGGCCGTGAGCCAAAGGATGTGG + Intergenic
1000397487 5:160791006-160791028 GGGTCATGAGCCAAGGAACCTGG + Intronic
1000863384 5:166483815-166483837 GGCCCATGAGCCAAACAGTTAGG - Intergenic
1001074954 5:168619332-168619354 GGGCCAAGAGACAGAGAATAGGG - Intergenic
1001289170 5:170444288-170444310 AGGCCATGAGCCAAAGAATGGGG - Intronic
1001309251 5:170598979-170599001 GGGCAGAGAGCCAAAGACTGAGG + Intronic
1001834633 5:174821447-174821469 GGACCATAAACCAAGGAATGTGG + Intergenic
1001963247 5:175893360-175893382 GGCCCATGAGCCAAAGAAAGTGG + Intergenic
1002447686 5:179299702-179299724 GGGCCACAAGCCAAGGAATGTGG - Intronic
1002478007 5:179480400-179480422 TGGCCATGAGCCAAGGGATGAGG - Intergenic
1002582201 5:180215670-180215692 GGGCCATGAGCAGAGGAATGTGG + Intergenic
1003418248 6:5932572-5932594 GGGCCATGAGCCAAGGAATGCGG - Intergenic
1003981250 6:11392282-11392304 GGGCCGTGAACCAAGGAATGTGG - Intergenic
1004472372 6:15940835-15940857 GGGCTATGAGCCAAGGGATGGGG - Intergenic
1004876687 6:19962706-19962728 GGGCCATGAACCAAGGAATGTGG + Intergenic
1004888300 6:20072699-20072721 GGGCCCTGAGCCAAGGAATGTGG - Intergenic
1005252529 6:23963934-23963956 GGGTCATGAGCCAGGGAATGTGG - Intergenic
1005418880 6:25629023-25629045 GCTCCATGAGCCAAAGGATGGGG - Intergenic
1006206744 6:32350899-32350921 GAGCCATGAACCAAGGAATGTGG + Intronic
1006662269 6:35657416-35657438 GGGCCACCAGCCAAGAAATGTGG - Intronic
1006773246 6:36571501-36571523 GGGCCATGAGCCAAGGAATGTGG - Intergenic
1007138630 6:39548369-39548391 GGGACATGATCCAAAGAAATGGG + Intronic
1007646050 6:43382057-43382079 GGGCCATGAGCCAAGAAATGTGG + Intergenic
1008030114 6:46686100-46686122 AGGCCATGAGCCATGGAAGGAGG + Intergenic
1008332479 6:50260785-50260807 TGGCCATGGGCCTATGAATGTGG - Intergenic
1008437130 6:51489342-51489364 GGGCAATGAGCCAAGAAATGTGG + Intergenic
1008740105 6:54596492-54596514 GGGCCATACACCAAAGAAAGTGG - Intergenic
1008881563 6:56385429-56385451 GGGCCATGAGCTAAGGACTGTGG - Intronic
1009186000 6:60575030-60575052 GGGTCATGAGTCAAGAAATGTGG + Intergenic
1009557277 6:65188796-65188818 GGGCCAGGAGCCAAGAAATGGGG + Intronic
1010365677 6:75048919-75048941 GGACCATCAGCCAAGGAATGCGG - Intergenic
1010732535 6:79405920-79405942 GAGCCACAAGCCAAGGAATGTGG + Intergenic
1011151665 6:84280738-84280760 GAACAATGAGCCAAATAATGTGG - Intergenic
1011325167 6:86142710-86142732 GGGCCATGAGCCAAGGAGGAGGG + Intergenic
1011626027 6:89284605-89284627 GAGCCAGGAGCCACAGAATGTGG + Intronic
1012027352 6:94013176-94013198 GGGTCAGGAGCCAAGGAAAGAGG + Intergenic
1012138472 6:95590011-95590033 AGTTCATGAGCCAAAGAATGTGG + Intronic
1012193885 6:96315669-96315691 GGGCAATGAGCCAGGGAATGGGG + Intergenic
1012225657 6:96700467-96700489 TGGCCACAAGCCAAGGAATGTGG - Intergenic
1012279727 6:97314496-97314518 GGTCTATGAGCCAAGGAATGTGG - Intergenic
1012471433 6:99576658-99576680 GAGCCATGAGCCAAGAAATGTGG - Intergenic
1012630545 6:101461446-101461468 GGGCCATAAGGTAAGGAATGTGG - Intronic
1013995080 6:116298480-116298502 GGGCCACTAGCCAAGGCATGTGG + Intronic
1014018554 6:116562847-116562869 GGGTCATGAGCTAAAGAATGTGG + Intergenic
1014212436 6:118720941-118720963 GGGCCACAAACCAAAGAACGTGG + Intergenic
1014282725 6:119459652-119459674 GTACCTTGAACCAAAGAATGAGG + Intergenic
1014426585 6:121314154-121314176 AGGCCATGAGCCAAGGAATGAGG - Intronic
1014510655 6:122317604-122317626 GGGGCATGAGCCAAGGAATGTGG + Intergenic
1014907959 6:127053196-127053218 GGGCTAAGTGTCAAAGAATGTGG + Intergenic
1015006717 6:128291252-128291274 GGGCCATAAGCTAAGGAAGGTGG + Intronic
1015820714 6:137257536-137257558 AGTCCATGAGCCAAAGAATGTGG - Intergenic
1015889347 6:137954328-137954350 CAGCCATGAGCCAAGGAATGCGG - Intergenic
1015971693 6:138748928-138748950 GGGCCACAAGCCAAGGAATGTGG - Intergenic
1016266250 6:142235483-142235505 GGACCATGAGCCAAGGAATGCGG + Intergenic
1016355054 6:143209561-143209583 GGGCAATGAACCAAGGAATGTGG + Intronic
1016885362 6:148954934-148954956 GGGCCATCAGCAAAGGAGTGAGG - Intronic
1016917567 6:149258972-149258994 GGGCCACAAACCAAAGAATGAGG + Intronic
1017326518 6:153146808-153146830 TGACCATGAGCCAAGGAATATGG + Intergenic
1018392086 6:163348355-163348377 AGGCCACAAGTCAAAGAATGTGG + Intergenic
1018415857 6:163601640-163601662 AGGCCATGAACCAAGGAGTGTGG - Intergenic
1018419440 6:163629536-163629558 GTGCCATGAGCCAAGGAATGTGG + Intergenic
1019659380 7:2215545-2215567 GGGCCACAAGCCAAGGAATGTGG - Intronic
1019739823 7:2667090-2667112 GGGCCACCAGCCAAGGAATGTGG - Intergenic
1019836401 7:3389447-3389469 GGGCCATGAGCCAAGGACAAGGG + Intronic
1020146795 7:5650624-5650646 TGGCCATGAGCCAAGGATTGAGG - Intronic
1020332947 7:7038791-7038813 GGGCCATGAGCTGAGTAATGTGG + Intergenic
1020613674 7:10432138-10432160 GGACCATGAGCCAGGGAATGAGG - Intergenic
1020707119 7:11559048-11559070 AGGCCAGGAGCCAAGGGATGTGG + Intronic
1020999483 7:15310882-15310904 GGGCCATGAGCCAAAGAATGCGG - Intronic
1021149522 7:17132471-17132493 GGGCCACGGGCCGAGGAATGCGG + Intergenic
1021421116 7:20445658-20445680 GGACGATGAGCTAAGGAATGTGG - Intergenic
1021574253 7:22093221-22093243 GAGCCATGAGCCAAGGAATGTGG - Intergenic
1021876824 7:25057600-25057622 GGGCCATTAGCCAAGGAGTGTGG - Intergenic
1022209790 7:28197111-28197133 GGGCCATGAGCCAAGGAATGGGG - Intergenic
1022314913 7:29236803-29236825 GGGCCATGAGCCAAGGAATATGG - Intronic
1022349348 7:29552723-29552745 AGACCATGAGCCAAGAAATGCGG - Intergenic
1022532024 7:31072942-31072964 GGGCCATGGGCCCAGGAATGTGG + Intronic
1022831542 7:34072474-34072496 GGGTCAGGAGCCAAGGAATGTGG - Intronic
1022911159 7:34900552-34900574 GGGCCCTGAGCCAAGGAATCAGG + Intergenic
1023019863 7:36001656-36001678 GGGCCATAAGCCAAGGAATGCGG + Intergenic
1023107669 7:36778627-36778649 AGGTCACAAGCCAAAGAATGTGG - Intergenic
1023143934 7:37130291-37130313 CAGCCATGAGCCAAAGGATGGGG - Intronic
1023152244 7:37213052-37213074 GGGCCAGGAGCTAAAGTCTGTGG + Intronic
1023284211 7:38602485-38602507 GGGCCATGCGCCAAGGAATATGG - Intronic
1023399981 7:39785656-39785678 GGGCCATGATCCAAGGAATGGGG + Intergenic
1023471296 7:40523676-40523698 AGGCCATAAGCCAAGGAATGTGG - Intronic
1023546645 7:41324903-41324925 GGGCCATGAGGCACAGAATGGGG - Intergenic
1023617041 7:42030152-42030174 GACCCCTGAGCCAAGGAATGTGG - Intronic
1024072912 7:45801425-45801447 GGGCCATGATCCAAGGAATGGGG + Intergenic
1024390483 7:48806155-48806177 GGACCATGAGCCAAGGAACAAGG - Intergenic
1024562012 7:50652805-50652827 GTGCAATAAGCCAAAGGATGAGG - Intronic
1024650424 7:51398753-51398775 GGGCCATGATCCAAGGAATGGGG - Intergenic
1024907094 7:54398003-54398025 GAGCCAAGAGCCAAGGGATGTGG - Intergenic
1025054564 7:55754417-55754439 GGGCCATGATCCAAAGAATGGGG - Intergenic
1025132620 7:56384564-56384586 GGGCCATGATCCAAGGAATGGGG - Intergenic
1025280405 7:57622865-57622887 GGACCAAGAGCCAGAGCATGAGG - Intergenic
1025304328 7:57842642-57842664 GGACCAAGAGCCAGAGCATGAGG + Intergenic
1025911351 7:65831408-65831430 GGGCCATGATCCAAGGAATGGGG + Intergenic
1025978273 7:66386790-66386812 GGGCCATGATCCAAGGAATGGGG - Intronic
1026213522 7:68327829-68327851 GGACCATCAGCCAAGGAATATGG + Intergenic
1026276542 7:68882697-68882719 TGGCCATGAGACAACGAATTTGG + Intergenic
1027203857 7:76081475-76081497 GGGCCATGATCCAAGGAATGGGG - Intergenic
1028720740 7:94027972-94027994 GGACCATGAGCCAAGGAATGAGG + Intergenic
1029057199 7:97759459-97759481 GAGCCATGAGCCAAAGATTGTGG + Intergenic
1029806415 7:103001789-103001811 GGGCCTTTGGCCACAGAATGAGG + Intronic
1030164197 7:106536471-106536493 GGGCCATGAGCCAAGGAATGTGG + Intergenic
1030177565 7:106670714-106670736 AAGCCATGAGCCATGGAATGTGG - Intergenic
1030251217 7:107447164-107447186 GAGCTATGAGCCAAGGAATGTGG - Intronic
1030267203 7:107632571-107632593 AGAACATGAGCCAAAGAATGCGG - Intergenic
1030284446 7:107811406-107811428 GGGTCATGAGCCAAGGAATGTGG - Intergenic
1030300395 7:107968647-107968669 GGACCATGAGTCAAGGAATGTGG + Intronic
1030323876 7:108199566-108199588 GGACCATGGGCCAAGGAATGTGG - Intronic
1030760380 7:113342756-113342778 AGTACATGAGCCAAGGAATGAGG - Intergenic
1030939430 7:115628004-115628026 GGGCCATGAGCAATGGAATGTGG + Intergenic
1030999505 7:116398382-116398404 GGGCTACAAGCCAAGGAATGTGG - Intronic
1031060149 7:117042017-117042039 GGGCCACAAGCCAAGGAATGTGG + Intronic
1031161626 7:118175897-118175919 GGGCCATGAGCCAAGAAATGTGG - Intergenic
1031586222 7:123534725-123534747 GGGGGAGGAGCCAAAGACTGGGG + Intronic
1031681964 7:124686486-124686508 GGTCCATGAGCCAAGGAATGTGG + Intergenic
1031809850 7:126352810-126352832 GAGCCATGAGCCAAAGAATGTGG - Intergenic
1032050295 7:128645126-128645148 GGGCCATGATCCAAGGAATGGGG + Intergenic
1032168359 7:129563552-129563574 GGACCATGAGCCAAGTAAAGTGG - Intergenic
1032168848 7:129567359-129567381 GGGCCATGAGCCAAGAACTGTGG + Intergenic
1032297172 7:130650065-130650087 GGGCCATGAGTCAAGGAATGTGG - Intronic
1032794512 7:135267073-135267095 GGGCCACAAGCCAAGGAATGCGG + Intergenic
1033005808 7:137560752-137560774 GGACTGTAAGCCAAAGAATGTGG + Intronic
1033414239 7:141148143-141148165 GGGCCATGAGCCAAGGAATGTGG - Intronic
1033577860 7:142703466-142703488 GGGCCACAAGTCAAGGAATGTGG + Intergenic
1034125892 7:148671306-148671328 GGGCAGTGAGCCAAGGAGTGTGG + Intergenic
1034407054 7:150911646-150911668 GCGCCATGAACCAGAGGATGTGG + Intergenic
1034969621 7:155410921-155410943 GGACCATGTGCTAAGGAATGTGG - Intergenic
1035152153 7:156883723-156883745 GGACCATGAGCCAAGGAGTGTGG - Intronic
1036189828 8:6660278-6660300 GGGCCATGAGCCAAGGAAGGCGG - Intergenic
1036675120 8:10825139-10825161 GGGCCAGGAGCCCAAAAGTGAGG - Intronic
1037226907 8:16603246-16603268 GGGCCATGAGCCAAGGAATGTGG + Intergenic
1037518877 8:19660872-19660894 GGTCCTTGTGCCATAGAATGAGG - Intronic
1037655037 8:20875789-20875811 GGGCCATGAGCCAAGTCATGTGG - Intergenic
1037909768 8:22737394-22737416 TGGCCATCAGGCAAAGAAGGGGG + Intronic
1038173347 8:25159112-25159134 AGGCCATGAGCCAAGGAATTTGG + Intergenic
1038853678 8:31307164-31307186 GGGCCATAAGCCAATCAATGTGG + Intergenic
1039077431 8:33704446-33704468 GAGCTATGAGTCAAAGAATGTGG + Intergenic
1039104331 8:33973910-33973932 GGGCCACAAGCCAAGGAATGTGG - Intergenic
1039232708 8:35465918-35465940 GGACCATGAGCCAAGGTGTGTGG + Intronic
1039432141 8:37533255-37533277 GGGCCATGAGTCAAGGAATGTGG - Intergenic
1039796491 8:40919874-40919896 GCTCCATGAGCTAATGAATGTGG - Intergenic
1040298815 8:46177392-46177414 GGGCCGTGCTCCAAAGACTGGGG - Intergenic
1040304390 8:46204527-46204549 GCACCATGATCCAAAGACTGGGG - Intergenic
1040370300 8:46764162-46764184 GAGCCATGAGCCAAGGGTTGTGG - Intergenic
1040421013 8:47240550-47240572 AGACCATAAGCCAAGGAATGCGG + Intergenic
1040521546 8:48180571-48180593 GGGCCATGAGTCAAAGAATTCGG - Intergenic
1040557412 8:48493153-48493175 AGGCCATGAGCCAAGGAATGAGG + Intergenic
1040657048 8:49522614-49522636 GGGCCATGAGCCAAGGAGTGTGG + Intergenic
1041173567 8:55170421-55170443 GGGACATGAGCCAAGGAATGTGG + Intronic
1041337341 8:56801123-56801145 GAGCCAGTAGCCAAAGACTGAGG + Intergenic
1041674677 8:60526331-60526353 GGGCCATGGGCCAAGGGATGTGG - Intronic
1041993575 8:64025730-64025752 GAGCCATGATCTAAGGAATGTGG + Intergenic
1042162072 8:65906398-65906420 GGTCCATGAGCCACAGACTGTGG + Intergenic
1042310670 8:67375977-67375999 GGGCCGCAAGCTAAAGAATGTGG - Intergenic
1042467305 8:69141998-69142020 GGCCTATGAACCAAGGAATGGGG - Intergenic
1042708709 8:71691027-71691049 GGTCCATTAGCCAAGGAATGTGG - Intergenic
1043174383 8:77005958-77005980 GGGCCAAGAGCCAATGAATGTGG - Intergenic
1043587048 8:81781594-81781616 CAGCCATGAGCCAAGGAATGCGG - Intergenic
1043730951 8:83680853-83680875 GAGCCATGAACCAAGAAATGTGG + Intergenic
1043927966 8:86059493-86059515 GGGTCATGAGGCAAGGAATAAGG - Intronic
1044056168 8:87571748-87571770 AGGCCATGAGCCAAGAAATAAGG - Intronic
1044189358 8:89296774-89296796 GGACCATGAGCCAAGGAATGTGG - Intergenic
1044234066 8:89809807-89809829 GGGCCAGGAGCAAAATGATGTGG + Intergenic
1044475562 8:92621263-92621285 AGGCCATGAGCCAAGGAATGTGG + Intergenic
1044590616 8:93910794-93910816 GAGTTATGAGCCAAAGAATGTGG + Intronic
1044647939 8:94464329-94464351 GGACCATGAGCCAAGGAATGTGG + Intronic
1044802868 8:95975083-95975105 GGGCCCCAAGCCAAGGAATGTGG + Intergenic
1044875223 8:96658769-96658791 GGGCCATGAGCCAAGGAATGTGG + Intronic
1044875229 8:96658793-96658815 TGGCCACGAGCCAAGGAATGTGG + Intronic
1044879437 8:96708074-96708096 GGGCCATGAACTAAGGAATATGG - Intronic
1045079002 8:98604113-98604135 GGGCCATGAGCCAAAGAATGTGG + Intronic
1045081238 8:98628226-98628248 AGGCCATGAGCGAAGGATTGTGG - Intronic
1045400448 8:101811337-101811359 GGGCCATGAGCCAAAGATGTAGG + Intronic
1045435888 8:102163436-102163458 GGGCCATGAACCAAGGAATGTGG - Intergenic
1045493530 8:102688927-102688949 GGCCCATGAGCAGAGGAATGTGG + Intergenic
1046259753 8:111752037-111752059 GGACCACAAGTCAAAGAATGTGG - Intergenic
1046395438 8:113633480-113633502 GGGCCATGAGCCAGGTGATGGGG - Intergenic
1046711552 8:117516994-117517016 GGACCACAAGCCAAGGAATGTGG + Intergenic
1046821989 8:118643895-118643917 GGGTCACAAGCCAAGGAATGTGG - Intergenic
1047002431 8:120586455-120586477 GAGCCAAGAGCCAAGGAATGTGG - Intronic
1047063627 8:121255391-121255413 GGGCCATGAGCCAAGGCATCTGG + Intergenic
1047136965 8:122090288-122090310 TGGCCATGAGCCAAGGAATGTGG - Intergenic
1047285521 8:123484356-123484378 GGGACATGAACCAAGGAATGAGG + Intergenic
1047690559 8:127349381-127349403 AGACCATGAGCCTAGGAATGTGG - Intergenic
1047927965 8:129699650-129699672 GGGCTATGAGCCAAGGGATGTGG + Intergenic
1047941197 8:129829142-129829164 GGGCCATGAGCCAGAGAAGGAGG - Intergenic
1048322445 8:133410677-133410699 GGGCCATGAGCCAAAGAATGTGG + Intergenic
1048514006 8:135088699-135088721 GGACCATGTCCCAAGGAATGTGG + Intergenic
1048573069 8:135670728-135670750 GGCCCATGAGCCAAGGAATGTGG + Intergenic
1048838558 8:138544697-138544719 GGGCCATGAGCCAAGGAGTGTGG + Intergenic
1049149485 8:141025378-141025400 GAGCCACGAGCCAAGGAATATGG - Intergenic
1050125532 9:2352999-2353021 GGGCCGTGAGGCAAGAAATGTGG - Intergenic
1050547967 9:6725028-6725050 GTGTCATGACCCAAGGAATGAGG - Intronic
1050635164 9:7604702-7604724 GGGCCATGAGCCAAGGAACATGG + Intergenic
1050821524 9:9885673-9885695 GGGCCACAAGTCAAAGAATGTGG + Intronic
1050858051 9:10387017-10387039 GGGCCATGAGTCAAGGAATGGGG + Intronic
1051419807 9:16877795-16877817 GGGCCATAAGCCAAGCATTGGGG - Intergenic
1051475579 9:17504740-17504762 CGGCCATGAGCCAAAGGATGTGG + Intergenic
1051551696 9:18337283-18337305 GGGCCTTCAGCCACAGACTGAGG + Intergenic
1051804513 9:20977097-20977119 GGGCCACAAGTCAAAGAATGTGG - Intronic
1052283046 9:26754544-26754566 GGTCCAGGAGCCAGAGACTGAGG + Intergenic
1052675528 9:31617479-31617501 GGGTCATGCGACAAAGAATGTGG + Intergenic
1052711812 9:32066281-32066303 GGCCCATGAGCCGAGGAATGTGG + Intergenic
1052841543 9:33295393-33295415 GAACCATGTGCTAAAGAATGTGG + Exonic
1052891348 9:33703270-33703292 GGGCCATGAGTCAAGGAATATGG + Intergenic
1053214746 9:36261051-36261073 GTGCCATGTGCCAAGGAATGTGG - Intronic
1053463908 9:38291037-38291059 GGGCCACCAGCCAAGGGATGTGG + Intergenic
1053655941 9:40218438-40218460 GGGCCATGAGGCAAAGAATAGGG + Intergenic
1053906287 9:42847640-42847662 GGGCCATGAGCCAAAGAATAGGG + Intergenic
1054352310 9:64028468-64028490 GGGCCATGAGCCAAAGAATACGG + Intergenic
1054368048 9:64364662-64364684 GGGCCATGAGGCAAAGAATAGGG + Intergenic
1054528672 9:66157857-66157879 GGTCCATGAGGCAAAGAATAGGG - Intergenic
1054675668 9:67854405-67854427 GGGCCATGAGGCAAAGAATAGGG + Intergenic
1054706314 9:68466034-68466056 AGGACAAGAGACAAAGAATGGGG - Intronic
1054734478 9:68736636-68736658 AGGCCATGAGTCAAGGAGTGAGG - Intronic
1054999876 9:71436669-71436691 GGACCATGAGCCAAGGAATGTGG + Intronic
1055671198 9:78607838-78607860 AGGCCATCAGCCAAGGAATGTGG + Intergenic
1055722072 9:79186262-79186284 GGGCCATGAGCCAAGGAATGTGG - Intergenic
1055955351 9:81768286-81768308 GGGCCACAAGCCAAGGAAAGTGG - Intergenic
1055957867 9:81791384-81791406 GGGCCATGATCCCAGGGATGTGG + Intergenic
1056028255 9:82524037-82524059 GGGCCATGAGCCAAAGAATGAGG - Intergenic
1056036247 9:82609037-82609059 AGACCATGAGCCAAGCAATGTGG - Intergenic
1056270847 9:84946857-84946879 GGGCCATGAGCCAAGAAATGTGG - Intronic
1056436571 9:86580381-86580403 GGTCCACAAGCCAAAGAATGCGG + Intergenic
1056821765 9:89847296-89847318 CGGCCGTGAGCCAAGGAATGTGG + Intergenic
1056833656 9:89936424-89936446 AGGCCATGAGAGAAAGAAGGGGG + Intergenic
1056983792 9:91342216-91342238 GGGCCATGAGCCAAGGAATGTGG - Intronic
1057226221 9:93294688-93294710 GGGCCAGGAGCCAGAGACAGAGG + Intronic
1057372879 9:94490012-94490034 GGGCCATGAGCCAAGGAATGGGG + Intergenic
1057962385 9:99469209-99469231 GGGCCACAAACCAAGGAATGTGG + Intergenic
1058036968 9:100263432-100263454 GGGTCATCAGCCAAGGAATGTGG - Intronic
1058441990 9:105017898-105017920 GAGCCATGAGCCAAGGAATGAGG - Intergenic
1058562580 9:106245601-106245623 TGGCCCTGAGTCAAGGAATGGGG - Intergenic
1058753848 9:108065875-108065897 GGGCCATGAGCCAAGAAATGTGG + Intergenic
1058762309 9:108146850-108146872 GGGCCACAAGCCAAGGAGTGTGG + Intergenic
1059087146 9:111316445-111316467 GGGCCATAAGCCAAGAAATGTGG + Intergenic
1059485480 9:114623591-114623613 GGGCCATGAGCCAGGGAATGTGG - Intronic
1059650154 9:116308784-116308806 GGGCAATGGGTGAAAGAATGGGG - Intronic
1059867051 9:118526874-118526896 GAATCATGTGCCAAAGAATGTGG + Intergenic
1059983576 9:119799454-119799476 GGGCCATGAGCCAAGGTACATGG - Intergenic
1060203906 9:121670575-121670597 TGGTCACGAGCCAAGGAATGTGG - Intronic
1060589787 9:124809509-124809531 AGGCCTGGAGACAAAGAATGGGG + Intronic
1060969928 9:127732141-127732163 GGGCCTGGAGCCAAGGGATGAGG - Exonic
1061162354 9:128902645-128902667 GGGCCAGGACCTAAAGACTGGGG - Intronic
1061229636 9:129307397-129307419 GAGCCATGAGTCAAGGAACGTGG + Intergenic
1061751790 9:132783248-132783270 GGGTTGTGAGCCAAGGAATGTGG + Intronic
1061755764 9:132811443-132811465 GGGCCACGAGCCAAAGCATGGGG + Intronic
1061819828 9:133220931-133220953 GGGCCACAAGCCAAGGCATGTGG + Intergenic
1061892618 9:133630749-133630771 GGGCCATGAGCCAAGGGATGTGG - Intergenic
1062240827 9:135537017-135537039 GGGCCACAAGCCAAGGCATGTGG - Intergenic
1062307227 9:135914859-135914881 GGGCCACAAGCCAAGGAATGTGG + Intergenic
1203541077 Un_KI270743v1:88249-88271 GGGACATGATCTAAAGAAGGAGG - Intergenic
1203631776 Un_KI270750v1:77648-77670 GGACCAAGAGCCAGAGCATGAGG - Intergenic
1185882118 X:3750786-3750808 GGGCCGTGAGCCAAGGAATGTGG + Intergenic
1186129200 X:6448180-6448202 TGGCTGTGAGCCAAGGAATGTGG - Intergenic
1186216380 X:7305669-7305691 GGGCCATGAGCCAAGGAAAGTGG - Intronic
1186365938 X:8893426-8893448 GGGGCATGAACCAAGTAATGAGG - Intergenic
1186437645 X:9556849-9556871 GGGCCATGAGCTAAGGAATATGG - Intronic
1186526084 X:10249592-10249614 GAGCCATGAGCCAAGAAACGTGG + Intergenic
1186529272 X:10278922-10278944 GGGCCATGAGCCAAGGAAGCTGG - Intergenic
1186532591 X:10312270-10312292 GGGCTATGAGCCAAGAAATGTGG - Intergenic
1186583009 X:10841006-10841028 GGGCCATGATCTAAGGAATGTGG + Intergenic
1186584752 X:10860972-10860994 GGGCCATGAGCCAAGGAATGTGG - Intergenic
1186624515 X:11278427-11278449 GGGCCATGAGCTAAGGAGTGTGG + Intronic
1186624978 X:11283751-11283773 GAAACATGAGCCAAGGAATGTGG + Intronic
1186644332 X:11490292-11490314 GGGACAGGAGGCAAGGAATGAGG + Intronic
1186703192 X:12113468-12113490 GAACCAAGAGCCAAGGAATGTGG - Intergenic
1187111261 X:16302988-16303010 GGGCCATGAGCCAAGGAATGTGG + Intergenic
1187410161 X:19044274-19044296 GGGGCATGAGCCAAGAAATGTGG - Intronic
1187479864 X:19645583-19645605 AGGGCATAAACCAAAGAATGTGG - Intronic
1187504081 X:19864562-19864584 GGGTCATGAGCCAAGGAATACGG + Intronic
1187727041 X:22214203-22214225 AGGTCATAAGCCAAGGAATGTGG - Intronic
1187728161 X:22225113-22225135 GGGCCATGAGCTAAGGAATGTGG - Intronic
1188142151 X:26564732-26564754 AGGCCATAAGCCAAGCAATGTGG + Intergenic
1188655736 X:32693145-32693167 GGGCAATGAGCCAGTGAATGTGG + Intronic
1188682436 X:33027306-33027328 AGGCCGTGAGCCAAATAACGTGG + Intronic
1188746473 X:33850832-33850854 GGGCTATGTGCCAAGGAATGTGG + Intergenic
1189264312 X:39702012-39702034 GGACCACGAGCCAAGGAATGTGG + Intergenic
1189958576 X:46303196-46303218 GGACCATGAGCCAAAGAATGTGG + Intergenic
1190465832 X:50724220-50724242 GAGCCATGAGCCAAGGAATATGG + Intronic
1190858839 X:54324103-54324125 TGACAATGAGCCAACGAATGTGG - Intronic
1191838433 X:65490325-65490347 GGACTATGAGCCAAAGAATGTGG + Intronic
1191899467 X:66025816-66025838 GGGCCATGAGCCAAAGAACGTGG + Intronic
1192568296 X:72181607-72181629 GGTCCAAGAGCCAAAGGACGGGG + Intronic
1192797300 X:74434553-74434575 GGGCACTGGGCCACAGAATGAGG + Intronic
1193429259 X:81380505-81380527 GAGCCATGAGACAAGGAATGTGG - Intergenic
1193777695 X:85664027-85664049 AGGTCATGAGCCAAGGAATGTGG - Intergenic
1194129234 X:90059633-90059655 GGGCCATGAGCCAAGGAGTGTGG + Intergenic
1194283943 X:91986616-91986638 GAGACATGAGCCAAGGAAGGTGG - Intronic
1194354978 X:92871770-92871792 GGGTCATGATCCAAGGAATGTGG - Intergenic
1194391679 X:93325738-93325760 GGGCCACAAGCCAAGGAATGCGG - Intergenic
1194467642 X:94253859-94253881 AGTCCCTGAGCCAAGGAATGCGG - Intergenic
1194520711 X:94915930-94915952 GGGCCTTTAGCCACAGAATGAGG + Intergenic
1194573741 X:95585518-95585540 GGGCCATGAGCCAAGAAATGTGG - Intergenic
1194861442 X:99003416-99003438 TGTCCATGAGCCAAGGAGTGTGG + Intergenic
1194915972 X:99709124-99709146 GGGCCATGTGGCAAGGAATGTGG - Intergenic
1194933492 X:99918120-99918142 GTGCCAAAAGCCAAAGAATTTGG - Intergenic
1195026516 X:100883013-100883035 AAGCCAGGAGCCAAGGAATGTGG + Intergenic
1195376747 X:104235051-104235073 GGGCCAGGAGCCAAGGAATGTGG - Intergenic
1195486470 X:105413490-105413512 GGACCATGAGCCATGGAATGTGG + Intronic
1195863946 X:109409493-109409515 AGGCTATAAGCCAAAGAATGTGG + Intronic
1196065714 X:111462048-111462070 TGTCCATGAGCCAAGGATTGTGG - Intergenic
1196123530 X:112075770-112075792 GGGCCATGCACTAAGGAATGTGG + Intronic
1196404753 X:115349451-115349473 TGGCCAATAGCCAAAGAAAGGGG + Intergenic
1196579750 X:117364831-117364853 GGACCGGGAGCCAAGGAATGTGG - Intergenic
1196656799 X:118227068-118227090 GAGCCAGGAGCCAAGGAATGTGG - Intergenic
1196685875 X:118509862-118509884 GGGCCATGAGCCAAGGAATGTGG - Intronic
1196755595 X:119154898-119154920 GAGACATGAGCCAAAGGAAGGGG - Intergenic
1196969631 X:121094897-121094919 GGGCCATAAGCCAAAGAATGTGG - Intergenic
1197010782 X:121560622-121560644 GGGCCATGAGCTAAGAAATGTGG - Intergenic
1197253565 X:124239394-124239416 GGGCCATAAGCCAAGAAATGTGG - Intronic
1197333482 X:125182157-125182179 GGGCCATGAGCCAAGGAAGGTGG - Intergenic
1198057332 X:133008035-133008057 GGGCCATGAGCCAAGGAATACGG - Intergenic
1198431216 X:136568029-136568051 CGGCCATGAGACAAGGAATGTGG - Intergenic
1198848120 X:140935404-140935426 GGGCCATAAGGCAAGGAATGTGG - Intergenic
1198920766 X:141723640-141723662 GGGCCATGAGCCAGGAAATGTGG + Intergenic
1199017270 X:142833139-142833161 GGACCATGAGCCAAGGGGTGAGG - Intergenic
1199460229 X:148075851-148075873 GGGCTGTGAGCCAAAGACTATGG + Intergenic
1199611631 X:149621728-149621750 GGGCCATGAGCTAAGGAATGTGG - Intronic
1199666009 X:150097108-150097130 GGGCCACAAACCAAGGAATGGGG - Intergenic
1199687739 X:150279687-150279709 GGGCCAGGAGACAAAGAGGGAGG - Intergenic
1199691079 X:150309446-150309468 GGGCCATGAGCCAAGAGGTGAGG - Intergenic
1200012670 X:153131291-153131313 GGGCGATGGGCCAACGCATGTGG - Intergenic
1200026930 X:153268626-153268648 GGGCGATGGGCCAACGCATGTGG + Intergenic
1200601511 Y:5211173-5211195 GAGACATGAGCCAAGGAAGGTGG - Intronic
1200663335 Y:5988785-5988807 GGGTCATGATCCAAGGAATGTGG - Intergenic
1200782855 Y:7232420-7232442 GGGCCGTGAGCCAAGGGATGTGG - Intergenic
1201154201 Y:11115025-11115047 GGGCCATGAGCCAAAGAATAGGG + Intergenic
1201479634 Y:14426008-14426030 AGGCTATGAGCCAAGGAATGAGG - Intergenic
1201704551 Y:16921883-16921905 GGTCCATGAAGCAATGAATGTGG - Intergenic
1202047778 Y:20751752-20751774 AGGTCATGAGTCAAGGAATGTGG + Intergenic