ID: 1141910430

View in Genome Browser
Species Human (GRCh38)
Location 16:87054867-87054889
Sequence CCAAAGAATGAGGCAGCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141910423_1141910430 13 Left 1141910423 16:87054831-87054853 CCTGCTGTCTTTGAAGACGAAGG No data
Right 1141910430 16:87054867-87054889 CCAAAGAATGAGGCAGCCTCTGG No data
1141910422_1141910430 14 Left 1141910422 16:87054830-87054852 CCCTGCTGTCTTTGAAGACGAAG No data
Right 1141910430 16:87054867-87054889 CCAAAGAATGAGGCAGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141910430 Original CRISPR CCAAAGAATGAGGCAGCCTC TGG Intergenic
No off target data available for this crispr