ID: 1141912098

View in Genome Browser
Species Human (GRCh38)
Location 16:87067100-87067122
Sequence GGCAGGCGCCAAGGGGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141912090_1141912098 -9 Left 1141912090 16:87067086-87067108 CCCTCCATGCTCAAGGCAGGCGC No data
Right 1141912098 16:87067100-87067122 GGCAGGCGCCAAGGGGGGCAAGG No data
1141912087_1141912098 19 Left 1141912087 16:87067058-87067080 CCTTTTGCTGCATGCAGAATGCG No data
Right 1141912098 16:87067100-87067122 GGCAGGCGCCAAGGGGGGCAAGG No data
1141912091_1141912098 -10 Left 1141912091 16:87067087-87067109 CCTCCATGCTCAAGGCAGGCGCC No data
Right 1141912098 16:87067100-87067122 GGCAGGCGCCAAGGGGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141912098 Original CRISPR GGCAGGCGCCAAGGGGGGCA AGG Intergenic
No off target data available for this crispr