ID: 1141919425

View in Genome Browser
Species Human (GRCh38)
Location 16:87126088-87126110
Sequence CAGCTGCCCCTCTGCCGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 5, 3: 28, 4: 240}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141919423_1141919425 -7 Left 1141919423 16:87126072-87126094 CCTCGTCGGAATAAGGCAGCTGC 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1141919425 16:87126088-87126110 CAGCTGCCCCTCTGCCGAGGAGG 0: 1
1: 0
2: 5
3: 28
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141919425 Original CRISPR CAGCTGCCCCTCTGCCGAGG AGG Intronic
900092099 1:925029-925051 CAGCGCCCCCTCGGCCGAGCCGG - Intronic
900095690 1:939263-939285 CAGCAGCGCCTCTGCTGGGGAGG - Exonic
900147890 1:1166353-1166375 CTCCTGCCCCCCTGCAGAGGCGG + Intergenic
900317836 1:2068288-2068310 CAGCTTCCCCTCTGGGGTGGGGG - Intronic
900485774 1:2922005-2922027 CAGCTGCCCTCCTGCAGAGCTGG - Intergenic
900586679 1:3435937-3435959 CAGCTCCCCCGCTGCCCCGGCGG - Exonic
901242241 1:7702224-7702246 CAGCCCCACCTCTGCCGAGCAGG - Intronic
901679718 1:10906083-10906105 AAGCAGCCCCTCTGGCCAGGGGG + Intergenic
902777296 1:18682941-18682963 CAGCTGCCCAGCTGCCTGGGTGG + Intronic
903126878 1:21254428-21254450 CAGCTGCACAGCTGCCAAGGTGG - Intronic
904030055 1:27528070-27528092 CAGCTGCCCCCCTGCCGGCCGGG - Intergenic
905545935 1:38800884-38800906 CAGCTGCAGCTGTGCCCAGGAGG - Intergenic
905627020 1:39495813-39495835 CACCTGCCTCTCTGCTGAGATGG - Intronic
905669916 1:39784958-39784980 CACCTGCCTCTCTGCTGAGATGG + Intronic
906055961 1:42917131-42917153 CAGCTGCCTCTCTGCAGGGCAGG - Intergenic
907267343 1:53270996-53271018 GAGCTGCCCCTCTGCCCTTGGGG + Intronic
911044462 1:93617169-93617191 CAGCAGCCCCTCAGCTGAGAAGG + Intronic
911539965 1:99146444-99146466 CAGCTGCAGCCCTTCCGAGGAGG - Intergenic
912413176 1:109491543-109491565 CAACTGCCTCTCTGAGGAGGAGG + Exonic
912544205 1:110439276-110439298 CAGCTGACCCTCTGTCAGGGAGG - Intergenic
914939144 1:152006840-152006862 AAGCTGCCCCGCTGCAGGGGGGG - Intergenic
914984399 1:152443553-152443575 CAGCTGCCCCTGAGCTGCGGTGG + Intergenic
920967346 1:210711972-210711994 CAGCTGTCCTTCTGCCGTTGTGG - Intronic
921308153 1:213817340-213817362 CAGCTGCCCTTCAGCCCAGTGGG - Intergenic
924477599 1:244395395-244395417 CAGTTTACCCTCTCCCGAGGTGG - Intergenic
1064086880 10:12351630-12351652 CAGCTGCACCTCTGCAGTGGCGG + Intronic
1064231937 10:13536823-13536845 CAGCTGGAGCTCTGCCAAGGTGG + Intergenic
1065596661 10:27319848-27319870 CAGCGGCCGCTCTGGGGAGGCGG + Intergenic
1067077852 10:43198254-43198276 CAGATGCCCCTCTGCAGAGCAGG + Intronic
1067428599 10:46227511-46227533 ATGCTGCCCCTCCCCCGAGGAGG + Intergenic
1068283780 10:54909648-54909670 CAGCTGCAGCTGTGCCTAGGAGG + Intronic
1071309438 10:84328768-84328790 CAGCTGGGCCGCGGCCGAGGAGG + Exonic
1071997723 10:91163510-91163532 CAGCGGCGCCTCCGCCGAGGAGG + Intronic
1072470343 10:95707269-95707291 CAGCTGCAGCCCTGCCCAGGAGG + Intergenic
1072726388 10:97816646-97816668 CAGCTGGCCCACTGCCTGGGTGG - Intergenic
1075017935 10:118924620-118924642 CACCTGCCCCTCTCCCTAGAGGG - Intergenic
1075671140 10:124264896-124264918 GAGCTGCCCTTCTCCAGAGGTGG + Intergenic
1077239382 11:1502675-1502697 CAGCTCCCCCACAGCCCAGGTGG + Intergenic
1077244900 11:1531969-1531991 CAGCTTCCCCACTGCCGAGGGGG - Intergenic
1077509857 11:2952834-2952856 CAGCTCCTGCTCTGCCCAGGTGG - Intronic
1078345645 11:10545206-10545228 CAGCTGCAGCTGTGCCCAGGAGG + Intergenic
1078474946 11:11622090-11622112 CACCGGCCCCTCTCCCGAGCCGG - Intergenic
1078619437 11:12893657-12893679 CAGCAGCCCCTCTGTAGAGATGG + Intronic
1078809375 11:14743163-14743185 CAGCTGCCCCTTCCCCCAGGTGG + Intronic
1081673880 11:44957158-44957180 CAGCGGGGCCGCTGCCGAGGCGG + Intergenic
1081831583 11:46120336-46120358 CGGCTGTCCCTCGGCCGGGGAGG - Intronic
1083756933 11:64796883-64796905 CAGGCGCCCATCTGCAGAGGAGG + Exonic
1084007012 11:66328441-66328463 CAGGGTCCCCTCTGCTGAGGCGG - Intergenic
1084215889 11:67646684-67646706 CTGCTTCCCCTCTGCCTATGTGG - Intronic
1085530928 11:77191622-77191644 CAGGTCCCGCTCAGCCGAGGAGG - Intronic
1088221776 11:107577432-107577454 CACCTTTCCCTCTGCCTAGGCGG - Intergenic
1089822666 11:121241974-121241996 CAGCTGCAGCTCTGTCCAGGAGG + Intergenic
1091097790 11:132840380-132840402 CAGCTGCCCCTTTGCTGAGGTGG + Intronic
1091206012 11:133821682-133821704 CAGCAGCCCCACTGCCAGGGTGG + Intergenic
1091404987 12:203617-203639 AAGCGGCCCCTGTGCCGCGGCGG + Intronic
1091752512 12:3031729-3031751 CAGTTTCCCCTCTGCAGATGAGG - Intronic
1095584484 12:43835753-43835775 CAGCTGCCGCTCTGCAGAGGCGG + Intergenic
1097203416 12:57299436-57299458 CAGTTGCCCTTCTGACAAGGAGG - Exonic
1102471882 12:113163928-113163950 CAGCTTCCCATCTGCAGAGTCGG - Intronic
1104019258 12:124980744-124980766 CCGCTGGCCCTCAGCTGAGGAGG - Exonic
1104411612 12:128562858-128562880 CAGCTTCCACTCTGCAAAGGTGG + Intronic
1105202953 13:18194912-18194934 CCCCTGCCCCTCTGCAGAGGGGG - Intergenic
1109416432 13:62046676-62046698 CAGCTGCCTCCCTGCCGGGCAGG - Intergenic
1109837358 13:67877365-67877387 CAGCTGCAGCTGTGCCCAGGAGG - Intergenic
1112502958 13:99956494-99956516 CTCCTGCCCCTCTGCCCCGGTGG + Intergenic
1112652562 13:101415851-101415873 CAGCGGCCCTGGTGCCGAGGGGG + Intronic
1113682338 13:112253237-112253259 CAGCTGTGCTTCTGCCAAGGGGG - Intergenic
1114066253 14:19061965-19061987 CCCCTGCCCCTCTGCAGAGGGGG - Intergenic
1114096015 14:19338059-19338081 CCCCTGCCCCTCTGCAGAGGGGG + Intergenic
1118029864 14:61809365-61809387 CAGCAGCCTTACTGCCGAGGAGG + Intergenic
1121985729 14:98503789-98503811 CAGCGGCCCCTCTGTCTATGAGG - Intergenic
1122502178 14:102208084-102208106 CATCTGCCCCTCTGCTCTGGCGG - Intronic
1122723570 14:103735866-103735888 CACCTCCCCCTCTACAGAGGGGG + Intronic
1122802759 14:104239776-104239798 CTGCTGCCCCTCTAGCCAGGAGG + Intergenic
1122806639 14:104263192-104263214 CAGCTGGCCCCCTCCCCAGGGGG - Intergenic
1122906051 14:104801984-104802006 CCGCTGCCCCTCAGCGGAGAGGG + Exonic
1124139746 15:27067108-27067130 CGGCTGCACCTTTGCCGTGGAGG + Intronic
1125525044 15:40369289-40369311 CAGCTGCGCCACAGCCGTGGGGG + Exonic
1125548834 15:40529097-40529119 AAGCTGCCGCTCTGCAGGGGTGG + Intronic
1125958936 15:43812295-43812317 CTGCTCCTCCTCTGCAGAGGTGG + Intronic
1128545658 15:68566000-68566022 CAGCTGCCTCTCCACAGAGGTGG - Intergenic
1128558291 15:68646520-68646542 CAGCTGCCCCTCTGATGGAGAGG - Intronic
1129850981 15:78793810-78793832 CAGCTGCCCCTCTCCAGGGCAGG + Intronic
1130333079 15:82936227-82936249 GAGATGCCCCTCTGAAGAGGTGG - Intronic
1130892392 15:88144320-88144342 CAGCTTCCCCTCTGTCCAGGGGG - Intronic
1132544245 16:526032-526054 CAGCTGCCTCTCTGGTGGGGAGG + Intergenic
1132574987 16:660143-660165 CAGCCCCCACTCTGCCAAGGTGG + Exonic
1132868524 16:2105240-2105262 AAGCTGCCCGTCTGCCCTGGGGG + Intronic
1133744450 16:8675834-8675856 CAGCTGGCCCTCTTCCAAGAGGG + Intronic
1133978451 16:10617007-10617029 GAGCTGCCCCTCTGGGGAGGGGG + Intergenic
1134523065 16:14927419-14927441 AAGCTGCCCGTCTGCCCTGGGGG - Intronic
1134549564 16:15132639-15132661 AAGCTGCCCGTCTGCCCTGGGGG + Intronic
1134685656 16:16156451-16156473 CAGCTGCCTCTCGGCCAGGGGGG - Intronic
1134710732 16:16326070-16326092 AAGCTGCCCGTCTGCCCTGGGGG - Intergenic
1134718903 16:16370358-16370380 AAGCTGCCCGTCTGCCCTGGGGG - Intergenic
1134948869 16:18342575-18342597 AAGCTGCCCGTCTGCCCTGGGGG + Intergenic
1134955853 16:18381801-18381823 AAGCTGCCCGTCTGCCCTGGGGG + Intergenic
1134982093 16:18619641-18619663 CAGCTCCCTTTCTGCGGAGGAGG - Intergenic
1135205059 16:20476641-20476663 CAGCAGCCTCTCTTCTGAGGTGG + Intronic
1135213838 16:20547172-20547194 CAGCAGCCTCTCTTCTGAGGTGG - Intronic
1138417322 16:56878986-56879008 CACCTCGCCCTCTGCAGAGGTGG + Intronic
1139051503 16:63129857-63129879 CAGCTGCCTCCCTGCCCAGCAGG + Intergenic
1139421758 16:66853497-66853519 GAGCTGCCCATCTGCCTAGCCGG + Exonic
1139594098 16:67948192-67948214 CAGGTCCCCAGCTGCCGAGGAGG - Intronic
1139813668 16:69647146-69647168 GAGCTGCTCCTCAGCCGTGGGGG + Exonic
1141642301 16:85348391-85348413 CAGCTCCACCTTTGCGGAGGAGG + Intergenic
1141919425 16:87126088-87126110 CAGCTGCCCCTCTGCCGAGGAGG + Intronic
1142804518 17:2364413-2364435 CAGCTGTCCATGTGCCGAGCGGG + Intronic
1144998680 17:19288534-19288556 CAGCTGCCCTTCTGCCTGGAAGG - Intronic
1148134435 17:45283228-45283250 CAGCTGTCCCTCTTGAGAGGTGG - Intronic
1148388570 17:47253953-47253975 CAGCTGCGACGCTGCCGAGCCGG - Intronic
1150809243 17:68343741-68343763 CTGCAGCACCTCTGCCAAGGTGG - Exonic
1150817155 17:68401368-68401390 CAGCTGCCCCGCTGTTGGGGTGG - Exonic
1151178142 17:72305954-72305976 CAGCTGCCCCTCTGGAAACGGGG - Intergenic
1151450311 17:74194709-74194731 CAGCAGCCCCTCAGCACAGGTGG - Intergenic
1151780203 17:76240427-76240449 CGGCGGCGCCTCTGCCAAGGGGG + Intergenic
1152571028 17:81121376-81121398 CAGCAGCAGCTCTCCCGAGGTGG - Exonic
1153331520 18:3879719-3879741 CAGCTGCCACTCAGCCGCGATGG - Exonic
1154453779 18:14502657-14502679 CAGGTGCACCTTTGCAGAGGTGG + Intergenic
1156160217 18:34350626-34350648 CAGCTGCAGCCCTGCCCAGGAGG - Intergenic
1157295289 18:46437838-46437860 CAGCTGCAGCCCTGCCTAGGTGG + Intronic
1159298135 18:66523415-66523437 CAGCTGCACCTCCTCCAAGGAGG - Intronic
1160989333 19:1854130-1854152 CTGCTGCCCCCCTCCCGGGGTGG - Exonic
1161393044 19:4031320-4031342 CAGCACCCCCTCTGCAGAGCAGG + Intronic
1161552829 19:4923611-4923633 CAGCTGCCCCTCTGCGCACGTGG + Intronic
1161773448 19:6243697-6243719 CAGCTGCCCCTCCCCCTAGAAGG + Intronic
1161925095 19:7294023-7294045 CCGCAGCCCCCCTGCCGGGGAGG + Exonic
1162918161 19:13885285-13885307 AACCTGCCTCTCTGCAGAGGCGG - Intronic
1163431201 19:17268824-17268846 CAGCAGCCCCACTGAAGAGGAGG + Exonic
1163807824 19:19410651-19410673 CAGCTCCTCCTGTGCCAAGGAGG + Intronic
925211428 2:2050778-2050800 CAGCTGCTGCTTTGCCGTGGCGG + Intronic
926098415 2:10097668-10097690 CATCTGCCCCTCAGTGGAGGGGG + Intergenic
926273958 2:11389290-11389312 CAGAGGTCCCTCTGCTGAGGAGG + Intergenic
929511241 2:42568033-42568055 CAGCTGGGTCTCTGGCGAGGCGG + Intronic
930429129 2:51251505-51251527 CAGCTGCCCCTCTGCTCAGGGGG - Intergenic
932081682 2:68721560-68721582 CAGCTCCTCCTCTCCCCAGGAGG + Intronic
932644752 2:73488512-73488534 CAGCTGCAGCTGTGCCCAGGAGG + Intronic
934500593 2:94857644-94857666 CAGCACCCTCTCTTCCGAGGAGG - Intergenic
934747830 2:96771038-96771060 CGGCTGGCCCTCGGCTGAGGGGG + Intronic
936502078 2:113074481-113074503 CTGCTGACCCTCTGCTGGGGAGG - Intronic
937288056 2:120765495-120765517 CAGCTGGCCCTCTCCCTTGGCGG - Intronic
938181436 2:129188621-129188643 CAGATGCCCCTCTGCTGAGCAGG - Intergenic
938483649 2:131682101-131682123 CCCCTGCCCCTCTGCAGAGGGGG - Intergenic
938736845 2:134193519-134193541 CAGCTGCCCTTGTGCCCAGGCGG + Intronic
940089217 2:149897228-149897250 CAGCACCTCCTCTGCCCAGGTGG + Intergenic
940911769 2:159215692-159215714 CAGATGACCCTCTCCCGAGATGG + Intronic
941553336 2:166943588-166943610 CCCATGCCCCTCTGCAGAGGTGG - Intronic
942868167 2:180700138-180700160 CAGCTGCTCCTATGCTCAGGAGG + Intergenic
946161027 2:217836156-217836178 CCCCAGCCCCTCTGCGGAGGCGG - Exonic
946168382 2:217879041-217879063 AAGCTGGCCCTCTGCCGAGAGGG + Intronic
947843068 2:233221025-233221047 CAGCAGCCCCTCTTCCCATGGGG - Intronic
948384336 2:237572221-237572243 CAGCGGGCCCTCAGCCGGGGTGG - Intergenic
948584643 2:239011720-239011742 CAGCAGCTCCACTCCCGAGGTGG + Intergenic
948625113 2:239263886-239263908 GAGCTTCCCCTCTGCAGAGAAGG - Intronic
948727442 2:239943810-239943832 CTGCAGCCCCTCTGCAGAGCTGG + Intronic
1169424372 20:5484914-5484936 CTGCTGCCCCTGTGGCAAGGTGG + Intergenic
1170492785 20:16895955-16895977 CAGCAGCCTCTCTGCCCTGGGGG - Intergenic
1170572856 20:17642186-17642208 CAGCTGCCCCTCAGAGGAGCTGG - Intronic
1172214450 20:33225257-33225279 CAGCTGCCCCTCCCCAGAGCTGG + Intronic
1172847806 20:37940304-37940326 CAGCTGCCCCTCTGGCTGTGGGG - Intronic
1173177675 20:40776967-40776989 CAGCTCCCTCTCTGGCAAGGGGG + Intergenic
1173764534 20:45595639-45595661 CAGCTGTCCCTCCTCCTAGGAGG + Intergenic
1175167543 20:57055423-57055445 CAGCAGGCCCTCTGCAGAGGGGG + Intergenic
1175959216 20:62626537-62626559 CTGGTGCCCCTCTGCCTGGGAGG - Intergenic
1176234152 20:64046475-64046497 CAGCACCCCCTCTGCATAGGTGG - Intronic
1176715006 21:10343093-10343115 CCCCTGCCCCTCTGCAGAGGGGG + Intergenic
1179800184 21:43808085-43808107 CAGGTGGGCCTCTGCAGAGGGGG - Intergenic
1180484731 22:15784556-15784578 CCCCTGCCCCTCTGCAGAGGGGG - Intergenic
1180603344 22:17036845-17036867 CCCCTGCCCCTCTGCAGAGGGGG - Intergenic
1181721751 22:24780645-24780667 CAACTGCCCCTCTGCTGACTTGG + Intergenic
1182338018 22:29598204-29598226 TAGCTGCCCCTCCGCGGAGAAGG - Intergenic
1182899380 22:33885302-33885324 TAGCTGACCCTCTGCGGAGGGGG + Intronic
1183469455 22:37997817-37997839 CAGCTCACCGTCTGTCGAGGGGG + Intronic
1183705094 22:39471104-39471126 TGGCTGCCCCTCTGCCTGGGAGG + Intronic
1184836835 22:47028980-47029002 CACCTGCACCTCTGCCCAGCTGG + Intronic
1184927552 22:47653888-47653910 TAGCTGCCTCTGTGCCAAGGAGG - Intergenic
1185045269 22:48525512-48525534 CGGCTGAACCTCTGCCCAGGTGG + Intronic
949226233 3:1699435-1699457 CAGCTGCAGCTGTGCCCAGGAGG - Intergenic
953101781 3:39836896-39836918 CAGATGGCCCTCTGGCGGGGAGG - Intronic
953286691 3:41617142-41617164 CAGCTGCCCCTTCCCCCAGGTGG - Intronic
954959288 3:54550254-54550276 CTGCATCCCCTCTGCTGAGGGGG + Intronic
958748439 3:98165396-98165418 TAGATGGCCCTCTGCCGGGGAGG - Intergenic
959920215 3:111860453-111860475 CAGCTGCGCCTCCGCCGCGCAGG - Intronic
960949532 3:122990215-122990237 CACCTCCCCCTCAGCAGAGGAGG - Intronic
961008688 3:123422126-123422148 CAAGTGCCCCTCTGCCCAGGAGG - Intronic
961328563 3:126125919-126125941 CAGCAGCCCCTCTTCCTAGCAGG + Intronic
961627451 3:128273837-128273859 GTGCTGCCCCACTGCTGAGGTGG + Intronic
964927376 3:161975411-161975433 CAGCTGCAGCTGTGCCCAGGAGG + Intergenic
968965310 4:3766449-3766471 CAGCCGGCCCTCGGCCGTGGTGG - Exonic
969089485 4:4682922-4682944 CAGCTGCCCCTCTGCTCACGAGG - Intergenic
969700135 4:8763331-8763353 CAGCAGCCCCTCAGCCGCCGAGG + Intergenic
971697035 4:29918993-29919015 CAGCTGGCCCTCTGCAGTGTAGG + Intergenic
975597853 4:76066987-76067009 CAGTTGCACCCCTGCCCAGGAGG + Intronic
976680055 4:87746083-87746105 CAGCTGCAGCTGTGCCCAGGGGG + Intergenic
978174584 4:105714252-105714274 CAGGTGCCACTCTGCAGAGAGGG - Intronic
979732773 4:124045055-124045077 TAGCTGCCCCTTGGCAGAGGGGG + Intergenic
980322876 4:131302454-131302476 CAGCTGCCACCCGGCCAAGGAGG + Intergenic
980461740 4:133124408-133124430 CAGTTGCCCCTCTGACAAGGAGG + Intergenic
982107302 4:152022211-152022233 CTGCTGACCCTCTGCCAAGCGGG - Intergenic
985082178 4:186277455-186277477 CAACTGCCCCTTTGCCAAGGTGG - Intronic
985956954 5:3272793-3272815 GAGCTGCCCCTCTTGCGGGGAGG + Intergenic
987129845 5:14850221-14850243 GAGCTGCCCCACTGCCTGGGTGG + Intronic
987412156 5:17625552-17625574 CAGCACCCTCTCTGCCGAGTTGG + Intergenic
989655769 5:43745841-43745863 CAGCTGCCCCTCTGGGAAGTGGG - Intergenic
991003665 5:61807104-61807126 AAGCAGCCCCTCTGCCAGGGGGG + Intergenic
991359440 5:65803755-65803777 CAGCTGCAGCTATGCCCAGGAGG + Intronic
993280563 5:85920378-85920400 CAGCTGCTGCTCTGGCAAGGGGG + Intergenic
995206637 5:109487982-109488004 CAGCTGCCTCCCTGCAGAGCAGG - Intergenic
996233213 5:121092067-121092089 CAGCTCCCTCACTGCTGAGGTGG - Intergenic
997362751 5:133305609-133305631 CCGCTGCCTCTCTACCCAGGTGG + Intronic
998638704 5:143985688-143985710 GAGCTGCCCCTCTGGGGAGATGG - Intergenic
1001105688 5:168852179-168852201 CTCCTGCGCCTCTGCCGGGGAGG - Intronic
1002189020 5:177469307-177469329 CCGCTGCCCCTCCCCCGGGGAGG + Intronic
1002300556 5:178255221-178255243 CAGCCGCCCCTCAGACCAGGTGG - Intronic
1003624097 6:7727062-7727084 CAGCTGCCCCCCGGCGGCGGCGG - Exonic
1006003049 6:30981414-30981436 CAGCAACCCCACTGCTGAGGAGG - Intergenic
1006688795 6:35861717-35861739 CAGCTGCCACTTGGCTGAGGAGG + Intronic
1007094499 6:39205041-39205063 CAGCTGCCCCCCTGCCCTGGGGG - Intronic
1007806329 6:44452107-44452129 CAGTGGCACCTCTGCCGGGGAGG - Intergenic
1014623198 6:123694893-123694915 CACCTGCCCCTCTGCCAACATGG - Intergenic
1017146603 6:151240649-151240671 CGGCGGCCCCTCGGCCGAGGCGG + Exonic
1017221434 6:151970122-151970144 CAGCTGACCCTTTTCCAAGGTGG + Intronic
1017707645 6:157138558-157138580 CAGCTGCTCTTCTGCAGATGTGG + Intronic
1017985088 6:159436559-159436581 CAGCCGCTCCTCTGCCGTGCAGG + Intergenic
1018050845 6:160006309-160006331 CAGCTGCGCATCTCCCTAGGCGG + Intronic
1018893165 6:167996711-167996733 CCGCTGTCCCTCCGGCGAGGAGG - Intronic
1019057741 6:169235363-169235385 AAGCTGTCCCTCTGCCATGGAGG + Intronic
1019195885 6:170282939-170282961 CAGGTGCTCCCATGCCGAGGAGG + Intronic
1019586894 7:1809912-1809934 CCTCTGTCCCTCTGCCCAGGAGG + Intergenic
1019715688 7:2538270-2538292 CAGAGGCCACCCTGCCGAGGTGG - Exonic
1020055954 7:5117638-5117660 CAGCTGCCCTTCTGCCGCGGCGG + Intergenic
1021097146 7:16547472-16547494 CAGCTGCAGCTGTGCCTAGGAGG - Intronic
1021129263 7:16891427-16891449 GAGCTGTCTGTCTGCCGAGGAGG + Intergenic
1021668632 7:23013532-23013554 CGGCCGCCCCTCTGCCGGGTGGG - Intronic
1022097052 7:27147658-27147680 CAGCTGCCCCTCTACCAGGCTGG - Exonic
1023232522 7:38049973-38049995 CAGCTGCCTCCCTGCCGGGCAGG + Intergenic
1023834302 7:44059403-44059425 CAGCTGGCTCTCTGCCAAAGTGG - Exonic
1025231955 7:57208374-57208396 AAGCAGCCCCACTGCCTAGGGGG + Intergenic
1032784467 7:135189365-135189387 CAGCTGCCCCTGTGACCAGCAGG + Exonic
1034210507 7:149358627-149358649 CAGCTGCAGCTGTGCCCAGGAGG + Intergenic
1034270657 7:149802132-149802154 CAGCTGCCCCCTGGCAGAGGAGG - Intergenic
1034554103 7:151839058-151839080 CAGCTGCCAGTCTGCAGAGCTGG - Intronic
1035278639 7:157763570-157763592 CAGCTGCCCCCCTGGCCATGGGG + Intronic
1037838874 8:22230341-22230363 CAGCTGCCCCTATTTCTAGGAGG - Intronic
1037876574 8:22551666-22551688 CTGGTGGCCCCCTGCCGAGGAGG - Intronic
1038290038 8:26241094-26241116 CAGCTGCACCTCTCCAGAGGAGG + Intergenic
1039996950 8:42541942-42541964 CGGCGGCCCATCTGCCGGGGCGG + Intronic
1041357384 8:57014643-57014665 CAGCTGCCGCTATGCCTGGGGGG + Intergenic
1041724549 8:61005876-61005898 CAGCTGCACCCCAGCCGAGGCGG + Intergenic
1046355731 8:113082176-113082198 CAGCTGCCCCATTGCTGAAGAGG - Intronic
1049433419 8:142575577-142575599 CAGGGACCCCTCTGCCAAGGTGG + Intergenic
1049621700 8:143601116-143601138 CAGCTGCCCCACTGCCAAGCTGG - Exonic
1049731320 8:144180018-144180040 CAGCAGCCCCTCAGCAGAGGAGG + Intronic
1049826955 8:144675030-144675052 CAGCTGCAGCTGTGCCCAGGAGG + Intergenic
1051232623 9:14968131-14968153 CAGATGGCCCTCTGGCGGGGAGG + Intergenic
1052261312 9:26519571-26519593 CCGCTGCCCATCTGCAAAGGTGG + Intergenic
1056382704 9:86069692-86069714 CAGCTAACCCTCTGCCCATGTGG - Intronic
1057182022 9:93035465-93035487 CTGCTGCAGCTCTGCGGAGGAGG - Exonic
1057877447 9:98768584-98768606 CAGAAGCCCCTCTGCAGAGCCGG + Intronic
1058091804 9:100813970-100813992 CAGCTGCAGCTCTACCAAGGAGG + Intergenic
1059262655 9:112993563-112993585 TAGCTGCCCCTTGGCAGAGGAGG + Intergenic
1060761067 9:126249261-126249283 CACCTCCACCTCAGCCGAGGAGG + Intergenic
1061487204 9:130925967-130925989 CAGTTTCCCCTCTGCTGAGCAGG + Intronic
1061679406 9:132235669-132235691 CGGCTGCCCCTCTCTCGAGCAGG + Intronic
1061809040 9:133151856-133151878 TTCCTGCCCCTCTGCCCAGGAGG + Intergenic
1062067475 9:134536474-134536496 CAGATACCCCTCAGCAGAGGAGG - Intergenic
1186207881 X:7219048-7219070 AAGCTGCACCTGTGCTGAGGTGG - Intergenic
1188744797 X:33829292-33829314 CGGCTGCCCCTCGGCAGAGCAGG + Intergenic
1192265427 X:69534161-69534183 CAGCTGCAGCTGTGCCCAGGAGG + Intergenic
1197854748 X:130902918-130902940 CAGCTCCACCTCTGCAGGGGAGG - Intronic
1199360142 X:146907686-146907708 CAGCTGCCAGCCTGCCAAGGAGG + Intergenic
1199831568 X:151553821-151553843 CCCCTGCCCCTCTGACAAGGAGG - Intergenic
1200092719 X:153643404-153643426 CTGCTGAGCCTCTGCCGAAGGGG - Intronic
1200213499 X:154357196-154357218 AAGCTGCCCCTCTGGGCAGGAGG + Intronic