ID: 1141920461

View in Genome Browser
Species Human (GRCh38)
Location 16:87132357-87132379
Sequence CAGGAGCCTGCACCTGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 540
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 500}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141920461_1141920468 24 Left 1141920461 16:87132357-87132379 CCAGGAACAGGTGCAGGCTCCTG 0: 1
1: 0
2: 2
3: 37
4: 500
Right 1141920468 16:87132404-87132426 CAGCTCCAGCCTGACCCACCTGG 0: 1
1: 0
2: 1
3: 60
4: 934
1141920461_1141920469 25 Left 1141920461 16:87132357-87132379 CCAGGAACAGGTGCAGGCTCCTG 0: 1
1: 0
2: 2
3: 37
4: 500
Right 1141920469 16:87132405-87132427 AGCTCCAGCCTGACCCACCTGGG 0: 1
1: 0
2: 6
3: 36
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141920461 Original CRISPR CAGGAGCCTGCACCTGTTCC TGG (reversed) Intronic
900032548 1:381708-381730 CAGGGGCCTGGGCCTGCTCCGGG + Intergenic
900053305 1:610770-610792 CAGGGGCCTGGGCCTGCTCCGGG + Intergenic
900319279 1:2074557-2074579 TAACAGCCAGCACCTGTTCCAGG + Intronic
900884953 1:5408568-5408590 CTGGAGCCAGCAGCTGTGCCTGG + Intergenic
901139825 1:7021296-7021318 CTGGAGCCTGCACCTGAACCGGG + Intronic
901464446 1:9412366-9412388 CAGGTGCCTGCCACTGTGCCTGG - Intergenic
902101894 1:13996989-13997011 CAGGTGCCTGCTCCTTTTTCTGG - Intergenic
902925500 1:19693338-19693360 CAGGAGCCTGCCACTATGCCCGG - Intronic
903615912 1:24656441-24656463 GAGAAGCCTGTAACTGTTCCAGG + Intronic
903953088 1:27007532-27007554 CAGGGGCCTGCCACTGTGCCCGG + Intronic
904063112 1:27726330-27726352 CGGGAGCCTGGACCGGGTCCCGG - Intronic
904199748 1:28812144-28812166 GAGGAGCCTGCGGCTGCTCCTGG + Exonic
904206120 1:28856395-28856417 CAGGACCCTGCATTTCTTCCAGG + Intronic
904300419 1:29550194-29550216 CAGGAGCCTGCTCCTGCTGAGGG - Intergenic
904852635 1:33470490-33470512 ACAGAGCCTGAACCTGTTCCAGG - Intergenic
905097843 1:35489807-35489829 CAGGCGCCTGCCACTGTGCCCGG + Intronic
906512658 1:46419681-46419703 CAGGCGCCTGCCACTGTGCCCGG + Intergenic
907364886 1:53949854-53949876 TAGGAGCCAGCTCCTTTTCCAGG - Intronic
907826921 1:58026867-58026889 CAGGTGCCTGCACCTGTCCAGGG + Intronic
908402322 1:63783041-63783063 CAGCAGCCTGCAGCTGCTCTGGG + Intronic
909803685 1:79847812-79847834 CTGGGGCTTGCTCCTGTTCCAGG - Intergenic
909844732 1:80377823-80377845 CAGGAGCCTGCCACTATGCCCGG + Intergenic
910104353 1:83615386-83615408 CAGGAGTCTGCAACTGTCACTGG - Intergenic
910676323 1:89820651-89820673 CAGGAGCCTTCACCCGTCCTGGG - Intronic
911184938 1:94893950-94893972 CAGGCGCCTGCCACTGTGCCTGG - Intronic
911588746 1:99721739-99721761 CAGGAGCCTGCCACTGCACCCGG + Intronic
912021170 1:105110688-105110710 CAAGAACCCGCAACTGTTCCTGG - Intergenic
912689890 1:111796922-111796944 CAGGAGCCTGCCGCTGTGACTGG - Intronic
915999643 1:160602741-160602763 CAGGCACCTGCCACTGTTCCTGG + Intergenic
916106360 1:161435500-161435522 CAGCAGCCTGGACCTGTTGCAGG + Intergenic
916455931 1:164970998-164971020 CATGAGCTTGGCCCTGTTCCAGG - Intergenic
916752710 1:167738066-167738088 CAGGCGCCTGCCACTGTGCCCGG + Intronic
917576007 1:176322558-176322580 TAGGAGCCTCGACATGTTCCTGG + Intergenic
917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG + Intronic
918458649 1:184754250-184754272 AAGGAGCCTGCACATGTCACCGG + Intronic
919002089 1:191845911-191845933 CAGGCGCCTGCCACTGTGCCCGG + Intergenic
919780394 1:201217231-201217253 CATGAGCCGGCACCTTTCCCAGG + Intronic
919790294 1:201286161-201286183 CAGGAGCCTGCTTTGGTTCCTGG + Intronic
920664988 1:207956835-207956857 CAGAAGCCTGCAAAAGTTCCAGG + Intergenic
920699102 1:208204302-208204324 CACAAGCCTGCATCTGATCCAGG + Intronic
920885434 1:209923384-209923406 CAGGTGCCTGCTACTGTGCCTGG - Intergenic
921063936 1:211609574-211609596 CAGGAGCCTCTCCCTGTTCCTGG + Intergenic
922758304 1:228108960-228108982 CAGGAGCCTGGGGCTGGTCCAGG + Exonic
922901879 1:229143614-229143636 AAGTAGCCTGGACCTGTTGCAGG - Intergenic
923472359 1:234303374-234303396 CAGGAGCCTTCTGCGGTTCCCGG + Intronic
924785162 1:247189076-247189098 CAGGCGCCTGCCACTGTGCCCGG - Intergenic
1063668786 10:8083072-8083094 CAGGTGCCTGCCACTGTGCCTGG - Intergenic
1065466813 10:26033214-26033236 CAGGAGCCCGCCACTGTGCCCGG + Intronic
1066247811 10:33600691-33600713 CAGGTGCCTGCCACTGTGCCCGG - Intergenic
1068416029 10:56724034-56724056 CAGGCGCCTGCCACTGTGCCCGG + Intergenic
1068967187 10:62924512-62924534 CAGGAGGCTGCAGCTGCACCTGG + Intergenic
1070688831 10:78509800-78509822 CAGGCCCCTGCACTTGCTCCTGG - Intergenic
1070847730 10:79537699-79537721 CAGGCGCCTGCCACTGTGCCTGG + Intergenic
1071337945 10:84617015-84617037 CAGGTGCCTGCAGCTCTCCCAGG - Intergenic
1072371766 10:94771709-94771731 CAGGAACCTGCAACAGTCCCTGG + Intronic
1072707900 10:97695276-97695298 CAGGCGCCTGCAACTGCACCCGG + Intergenic
1073495596 10:103888221-103888243 CTGGGGCCTGGACCTGTGCCAGG - Intronic
1073753428 10:106555752-106555774 CAGGCCCCTGCACTTCTTCCTGG - Intergenic
1073970640 10:109042937-109042959 CAGGAACCTGCAACGGTCCCTGG - Intergenic
1074613698 10:115044910-115044932 CAGGAGCCTGGGCCAGTCCCTGG - Intergenic
1075643687 10:124084054-124084076 CAGGAGGCTGCACCTTTGCAAGG + Intronic
1076503109 10:130952414-130952436 CAGGGGCCTGGCCCTGTTCTAGG - Intergenic
1076796111 10:132799242-132799264 CAGGACACCGCACCTGTGCCCGG + Intergenic
1076851472 10:133095518-133095540 GAGGAGCCTGGACCTGTGCGAGG - Intronic
1076866098 10:133167136-133167158 CAGGAGCCGACACCTGCTCTGGG + Intronic
1077147665 11:1053229-1053251 CAGGAGCCTGCACCCCTACGCGG + Intergenic
1078750157 11:14154091-14154113 CAAGTGCCTGCAGCTTTTCCAGG + Intronic
1080097688 11:28428837-28428859 CTGGAGCCTGCATCTGTCACTGG + Intergenic
1080433253 11:32217517-32217539 CAGGCGCCTGCCACTGGTCCCGG - Intergenic
1080890022 11:36401276-36401298 CAGCCTCCTTCACCTGTTCCAGG - Exonic
1081065488 11:38535075-38535097 CAGCGGCCTGGACCTGTTGCAGG + Intergenic
1081102292 11:39019577-39019599 CAGGAGGTTGCACCTGTTTAAGG - Intergenic
1081106643 11:39078652-39078674 CAGGGGCCAGCACGTGTTCAGGG + Intergenic
1082017891 11:47505790-47505812 CAGGTGCCTGCTACTGTGCCTGG - Intronic
1082260132 11:50072083-50072105 CAGGAGGCTGTAGCTGGTCCTGG + Intergenic
1083441851 11:62681904-62681926 CAGGAGCCTGCAACTATGCCCGG - Intergenic
1083443232 11:62690509-62690531 CAGGAGCCTGAACCTGGGCCAGG + Exonic
1084027367 11:66459954-66459976 CAGGAGCATGCCACTGTGCCTGG - Intronic
1084051155 11:66600828-66600850 CAGGAGCCTGCAAGAGGTCCTGG + Intronic
1084072530 11:66745392-66745414 CAGAAACCTGCACCTGCACCGGG - Intronic
1084866568 11:72062991-72063013 CTGCAACCTCCACCTGTTCCAGG - Intronic
1085537123 11:77228533-77228555 CAGGTGCCTGCCACTGTGCCTGG - Intronic
1085605195 11:77891339-77891361 GAGGATCCTGCACATGCTCCAGG + Exonic
1086318561 11:85619689-85619711 CAGGCGCCTGCCACTGTGCCTGG - Intronic
1086466846 11:87062605-87062627 CAGGCGCCTGCCACTGTGCCCGG + Intronic
1086934462 11:92729567-92729589 CAGGAGCGTGCCCCCGTGCCTGG + Intronic
1089219567 11:116859400-116859422 CTGGAGCCTGCAGCTGTGCCTGG + Exonic
1089255354 11:117191132-117191154 CAGGCGCCTGCCACTGTGCCCGG - Intronic
1089682061 11:120124097-120124119 CAGTAGCCCACACCTGTGCCTGG - Intronic
1090782155 11:130016853-130016875 CAGGTGCCTGCCACTGTGCCCGG - Intergenic
1090991138 11:131817891-131817913 CTGGTGCCAGCTCCTGTTCCTGG + Intronic
1091140861 11:133233413-133233435 CAGGAGCATTCTCCTCTTCCTGG - Intronic
1091372204 11:135070415-135070437 CAGGTGCCTGCCCCAGTGCCTGG + Intergenic
1093861957 12:24176685-24176707 TGGGAGTCTGCTCCTGTTCCTGG + Intergenic
1094708080 12:32934184-32934206 CAGGTGCCTGCCACTGTGCCTGG + Intergenic
1095277654 12:40307922-40307944 CAGGCACCTGCCACTGTTCCCGG + Intronic
1095529748 12:43172935-43172957 CAGGAGCCTGCCACTATGCCTGG + Intergenic
1095983635 12:47986108-47986130 CTGGAGCCTGCCCCGCTTCCTGG + Intronic
1096665672 12:53162423-53162445 CAGGCGCCTGCCACTGTGCCTGG - Intronic
1096993814 12:55826655-55826677 CAGGCGCCTGCCACTGTGCCTGG - Intronic
1097112696 12:56673648-56673670 CAGGCGCCTGCCACTGTGCCTGG - Intronic
1097955828 12:65484324-65484346 CAGGGTCCTGCACCTGGCCCAGG + Intronic
1098417907 12:70257501-70257523 CAGGTGCCTGCCACTGTGCCCGG + Intronic
1098895168 12:76051640-76051662 CAGGTGCCTGAAGCTGTACCTGG + Intronic
1098918144 12:76278244-76278266 CAGGAGACTGATCCTGATCCTGG + Intergenic
1099328760 12:81254065-81254087 CAGGTGCATGCAACTGTGCCTGG + Intronic
1100621844 12:96284316-96284338 CAGGCGCCTGCCCCTGCGCCTGG - Intronic
1101311891 12:103588188-103588210 CATGATTCTGCACCTGTGCCAGG + Intronic
1102113626 12:110384057-110384079 CAGGCGCCTGCCACTGTGCCTGG - Intronic
1104644040 12:130484539-130484561 AAGGTGCCTGCTCATGTTCCAGG - Intronic
1104884774 12:132100373-132100395 CAGGAGCCTGTGCTTGTACCTGG - Intronic
1104932348 12:132346312-132346334 CAGGGGCCTTCACCTGCTCTCGG + Intergenic
1104990445 12:132621343-132621365 CAGGTGCCTGCACCTGCTGGGGG + Exonic
1105311129 13:19212440-19212462 CAGGTGCCTGCCACTGTGCCCGG - Intergenic
1105959569 13:25318183-25318205 CAGGTGCCTGCCACTGTGCCCGG - Intronic
1106123096 13:26878175-26878197 CAGGATCCTAGACCTTTTCCTGG - Intergenic
1107009129 13:35650557-35650579 CAGGTGCCTGCCACTGTGCCTGG - Intronic
1107644352 13:42478576-42478598 CTGGGTCCTGCTCCTGTTCCAGG + Intergenic
1108663736 13:52608943-52608965 CAAGAGCCTGGAACTGTGCCTGG - Intergenic
1110244741 13:73310038-73310060 CAGGTGCCTGCCACTATTCCCGG - Intergenic
1112508356 13:99988909-99988931 CAGGAGCCTGGGCCTGGGCCTGG + Intergenic
1113038092 13:106073425-106073447 CAGGAGGCTGCCCCTGGTCTCGG - Intergenic
1113679090 13:112229826-112229848 GAGGATTCTGCAACTGTTCCAGG - Intergenic
1113923630 13:113928503-113928525 TGGGAACCTGCACCTCTTCCTGG - Intergenic
1114205843 14:20570572-20570594 CAGCAGCCTGGACATGTTGCAGG - Intergenic
1114420918 14:22582062-22582084 CAGGAGCCTGCCACTGCACCCGG - Intronic
1115351201 14:32397518-32397540 CAGGTGCTTGCCACTGTTCCTGG + Intronic
1117365479 14:55022965-55022987 CAGGTGCCTGCCACTGTGCCTGG + Intronic
1118216568 14:63814125-63814147 CAGGTGCCTGCCACTGTGCCTGG - Intergenic
1118580514 14:67291425-67291447 CAGGTGCCCGCCACTGTTCCCGG + Intronic
1119643594 14:76331798-76331820 CTGGTCCCTGCACCTGTGCCAGG + Intronic
1119822467 14:77629561-77629583 CAGGCGCCTGCCACTGTGCCTGG - Intergenic
1120210412 14:81628558-81628580 CAGAAGCCTCCACCACTTCCAGG - Intergenic
1121577783 14:95002468-95002490 CAGGAGTCTGCATCTGCTCCCGG + Intergenic
1122143609 14:99676255-99676277 GAGGAGCCAGCACCTGCTCAGGG + Exonic
1122174934 14:99909835-99909857 CAGGGGACAGCACCTTTTCCCGG + Intronic
1123991277 15:25685373-25685395 CAGGAGGCTGTGCCCGTTCCAGG + Intronic
1124461285 15:29894632-29894654 CAGGTGCCTGCAGCTCTCCCAGG + Intronic
1125746050 15:41997923-41997945 CAGGAGCCTGGACTTGTTTGGGG - Intronic
1127118601 15:55751459-55751481 CAGGAGCTTGAACCTTGTCCTGG + Intergenic
1128225841 15:66000831-66000853 CAAGTGCCTTCACCTCTTCCTGG - Intronic
1128394431 15:67209793-67209815 CAGGTGCCTGCCACTGTGCCTGG + Intronic
1128906768 15:71474360-71474382 CAGGCGCCTGCCCCTGTGCCTGG + Intronic
1129512768 15:76137138-76137160 CAGGAGGCTCCAGCTGTCCCTGG - Intronic
1130021142 15:80232878-80232900 CAGGAGCCAGAACCTGAGCCTGG - Intergenic
1130135829 15:81181282-81181304 CAGGATGCTGCAGCTGTGCCAGG - Intronic
1130926541 15:88389797-88389819 CAGGAGGCTTCACCTGGTCATGG - Intergenic
1132546170 16:534389-534411 GAGCGGCCTGCACCTGTTTCTGG + Intronic
1133182169 16:4065269-4065291 AAGGAGCATGCACGTGTTCGGGG - Intronic
1134639481 16:15818575-15818597 CAGGCGCCTGCCACTGTGCCTGG + Intronic
1134651643 16:15913803-15913825 CAGGGGCCTGCCACTGTGCCTGG + Intergenic
1135032214 16:19047537-19047559 CAGGAGCCTGCCACTGCGCCTGG + Intronic
1135416910 16:22275483-22275505 CAGGTGCCTGCCACTGTACCCGG + Intronic
1135752940 16:25071366-25071388 TAAGAGCCTGCCACTGTTCCAGG - Intergenic
1136282126 16:29220183-29220205 CCGGAGGCTGCTGCTGTTCCTGG + Intergenic
1136427386 16:30178104-30178126 CAGGAGCCTGCCACCGCTCCCGG - Intergenic
1136686236 16:31996384-31996406 CAGGATCCTGCACCAGTGCTTGG + Intergenic
1136786849 16:32939913-32939935 CAGGATCCTGCACCAGTGCTTGG + Intergenic
1136853545 16:33634038-33634060 CACTTGCCTGAACCTGTTCCTGG + Intergenic
1136882923 16:33913877-33913899 CAGGATCCTGCACCAGTGCTTGG - Intergenic
1137553306 16:49455008-49455030 CTGGATCCCGCACCTGTTTCAGG - Intergenic
1137859445 16:51831402-51831424 CAGGTGCCTGCCACTGTGCCTGG + Intergenic
1138017981 16:53448297-53448319 CAGGTGCCTGCCACTGTGCCCGG + Intronic
1138488429 16:57361637-57361659 CTGGGGCCTGCACCTGCACCTGG + Intronic
1138677562 16:58663057-58663079 CAGGCGCCTCCACCGGTGCCTGG - Intergenic
1139034769 16:62930781-62930803 CAGCAGCCAGTAACTGTTCCAGG - Intergenic
1139441225 16:66968447-66968469 CATGAGGCTGCACCCGGTCCTGG + Intronic
1139497827 16:67334172-67334194 CAGGTGCCTGCCACTGTGCCCGG + Intronic
1140033873 16:71358667-71358689 CTGGAGCCTGCGCCTGCGCCCGG - Intergenic
1140426398 16:74865383-74865405 CAGGCGCCTGCCACTGTGCCTGG + Intergenic
1141697784 16:85628306-85628328 CAGGAGCCTGCAGCTGACACCGG + Intronic
1141888060 16:86906640-86906662 CAGGAGACTTCTCCTTTTCCTGG - Intergenic
1141920461 16:87132357-87132379 CAGGAGCCTGCACCTGTTCCTGG - Intronic
1141945413 16:87305789-87305811 CAGGAGCCGGTAGCTGGTCCTGG + Exonic
1142011431 16:87716787-87716809 CAGGCGCCTGCCACTGTGCCTGG - Intronic
1142262714 16:89050322-89050344 GAGGGACCTGCACCTGTTGCTGG + Intergenic
1142289157 16:89184842-89184864 CAGGAGCCAGCACCTGACCCAGG + Intronic
1203089085 16_KI270728v1_random:1201583-1201605 CAGGATCCTGCACCAGTGCTTGG + Intergenic
1203115139 16_KI270728v1_random:1482483-1482505 CACTTGCCTGAACCTGTTCCTGG + Intergenic
1142597485 17:1036571-1036593 CTGGAGCCTGCACCTGTCTTTGG - Intronic
1143330538 17:6131767-6131789 CAGGAGCCTGCACCAGGTCCAGG - Intergenic
1143694811 17:8605599-8605621 CAGGCGCCTGCCACTGTGCCCGG - Intronic
1143952465 17:10644546-10644568 CAGGGTCCTGCACCCTTTCCCGG + Intronic
1144108385 17:12007768-12007790 CAGGAGCCACCACATGCTCCTGG - Intergenic
1144368984 17:14571891-14571913 CTGGTGCCAGCATCTGTTCCTGG + Intergenic
1144640209 17:16932686-16932708 AAGGAGCCTACTCCTGGTCCAGG - Intronic
1144672394 17:17140307-17140329 CCAGAGACTGCACCTGTCCCAGG - Intronic
1144912709 17:18696227-18696249 CAGGTGCCTGCCACTGCTCCTGG + Intergenic
1145761861 17:27429920-27429942 CAGAAGCCCCCACATGTTCCTGG - Intergenic
1146421605 17:32691547-32691569 CAGGCGCCTGCCCCTATGCCCGG + Intronic
1146659952 17:34659050-34659072 CAGCATCCTGGGCCTGTTCCTGG - Intergenic
1147147198 17:38492052-38492074 CAGGATCCTGCACCAGTGCTTGG + Intronic
1147363403 17:39945058-39945080 AGGGAGCCTGCACCTGGCCCAGG + Intergenic
1148182522 17:45616964-45616986 CAGGAGCTTGCACTAGTCCCAGG - Intergenic
1148266335 17:46228732-46228754 CAGGAGCTTGCACTAGTCCCAGG + Intergenic
1148437717 17:47695799-47695821 CAGGAGCCTGCCCCTGCTGCCGG + Exonic
1148841509 17:50501565-50501587 CAGGAGCCTGCCACTGCGCCTGG + Intergenic
1149641327 17:58204804-58204826 CAGCAGCCTGCACTTGCTCCAGG - Exonic
1149707599 17:58709219-58709241 CAGGTGCCTGCCACTGTGCCTGG + Intronic
1150891332 17:69153503-69153525 CAGGAGCCTTAAGTTGTTCCTGG + Exonic
1151089478 17:71420433-71420455 CAGGAGCCTACAACTGTGCCTGG - Intergenic
1151496322 17:74460313-74460335 CTGGAGGCTTCCCCTGTTCCTGG + Intergenic
1151569204 17:74917709-74917731 CGGGAGGGTGCACCTGTCCCGGG - Exonic
1151742679 17:75994618-75994640 CAGGCGCCTGCCACTGTGCCTGG + Intronic
1152376383 17:79920881-79920903 CTGGAGCCTGCCCCAGTCCCAGG - Intergenic
1152415099 17:80154661-80154683 CAGGCGCCTGCCACTGTGCCCGG + Intergenic
1152465777 17:80465361-80465383 CAGGTGCCTGAAACTGTTCTCGG - Intergenic
1152684805 17:81688730-81688752 CAAGATCCTGTACCTGATCCAGG + Exonic
1152762420 17:82115938-82115960 CAGGTGCCTGCAACCGTGCCAGG + Intronic
1152780652 17:82226178-82226200 CAGGTGCCTCCACCTGCCCCTGG - Intergenic
1152947392 17:83205474-83205496 CAGGGGCCTGGGCCTGCTCCGGG - Intergenic
1153138199 18:1941722-1941744 CTGGTGCCTGCAGCTTTTCCAGG - Intergenic
1154968281 18:21381263-21381285 CAGGCGCCTGCCACTGTGCCCGG - Intronic
1155128477 18:22904237-22904259 CAGGTGCCTGCCACTGTGCCTGG - Intronic
1155210456 18:23596180-23596202 CAGGTACCTGCCCCTGTGCCCGG + Intergenic
1155367264 18:25060951-25060973 CTCGAGCCTTAACCTGTTCCAGG - Intergenic
1155575592 18:27242636-27242658 CAGGTGCCAGCTACTGTTCCAGG - Intergenic
1156736289 18:40263469-40263491 CAAGAGCCTGCAGCTTTTCCAGG - Intergenic
1157189730 18:45570700-45570722 CAGGACCATGCACCTCCTCCTGG + Intronic
1157324260 18:46657507-46657529 GAGGAGCCCTCACCTGTCCCTGG - Intergenic
1157330732 18:46702002-46702024 CAGGTGCCTGCCACTGTGCCAGG - Intronic
1157332942 18:46716621-46716643 AAGGAGCCTGCAGCTGTGCCTGG + Intronic
1157449580 18:47775135-47775157 CAGGCGCCTGCCACTGTGCCTGG - Intergenic
1157510283 18:48266665-48266687 CAGAAGCTTGCCCCTGTGCCTGG - Intronic
1157682292 18:49616500-49616522 CAGCCGCCTGCACCTATCCCAGG + Intergenic
1157901979 18:51526716-51526738 CAGGGGCCTGCAGGTGGTCCTGG - Intergenic
1158653347 18:59307359-59307381 CAGGAACCTGAACCTGTTCTAGG + Intronic
1159667567 18:71180624-71180646 CAGGAGCCTGCCACTATGCCCGG - Intergenic
1160344776 18:78123914-78123936 CAGGTGCCTGCACCTCTCCGTGG + Intergenic
1160455448 18:78995870-78995892 CAGGAGCCTGGGCCTCTCCCGGG + Intronic
1160829813 19:1098505-1098527 CGGGAGCCTGGACCAGGTCCTGG + Intergenic
1160907443 19:1458099-1458121 GAGGAGCCACCACCTGTTCGGGG - Intronic
1161534645 19:4811626-4811648 CAGGAACCTTCACTTGTCCCAGG - Intergenic
1162214781 19:9124878-9124900 CAGGCGCCTGCTACTGTGCCTGG - Intergenic
1162812710 19:13174009-13174031 CAGGCGCCTGCAACTATGCCCGG + Intergenic
1162919599 19:13892735-13892757 CAGGAGGCTGCACCTGCGCTGGG + Intronic
1163342460 19:16718131-16718153 CAGGAGCATGCCACTGTGCCTGG + Intergenic
1163764905 19:19158228-19158250 CAGGTGCCTGCCACTGTGCCCGG + Intronic
1163963827 19:20724684-20724706 CAGGTGCCTGCCACTGTGCCTGG + Intronic
1163990388 19:20993688-20993710 CAGGTGCCTGCCACTGTGCCTGG - Intergenic
1164275686 19:23715585-23715607 CAGGTGCCTGCCACTGTGCCTGG - Intergenic
1166152560 19:40884508-40884530 CACCAGCCTGCACCTGGGCCTGG + Intronic
1166448712 19:42880095-42880117 CAGGAGGCTGGAGCTGTACCAGG + Intronic
1167439939 19:49502273-49502295 CAGGTGCCTGCCACTGTGCCTGG - Intergenic
1167997940 19:53421655-53421677 CAGGTGCCTGCCACTATTCCTGG + Intronic
924963811 2:57687-57709 TTGGAGCCTGCACCTGTAGCAGG - Intergenic
925481694 2:4282604-4282626 CAGGTGCCTGCCACTGTGCCCGG + Intergenic
925808312 2:7673984-7674006 CAGGAGTCTGGCCCTGTCCCTGG - Intergenic
925852155 2:8092580-8092602 CAGGAGCCTGCAAAAGTTTCAGG + Intergenic
926691699 2:15739334-15739356 CTGGAACTTTCACCTGTTCCTGG - Intronic
927054721 2:19357869-19357891 CTGGGGCATGCACCTGTCCCTGG + Intronic
927481936 2:23460881-23460903 CAGGAGCTTCCAGCAGTTCCGGG + Intronic
927555491 2:24028242-24028264 CAGGCGCCTGCCACTGTGCCTGG - Intronic
928004105 2:27548122-27548144 CAGGCGCCTGCCACTGTGCCTGG + Intronic
928580800 2:32705698-32705720 CAGGTGCATGCAACTGTGCCTGG + Intronic
928606280 2:32947335-32947357 CAGGAGCCCCCACCTGAGCCAGG - Exonic
929606427 2:43237539-43237561 CAGGTGCCTGCCGCTGTGCCTGG + Intronic
930385032 2:50683487-50683509 CAGGAGCCCGCCACTGTGCCCGG - Intronic
930536633 2:52652463-52652485 CAGCAGCCTGGACCTGTTGCAGG + Intergenic
931408496 2:62004442-62004464 CAGGTGCCTGCCACTGTGCCTGG + Intronic
932253237 2:70262620-70262642 CAGGTGCCTGCCACTGTGCCTGG + Intronic
933172727 2:79141399-79141421 CAGGTGCCTGCCACTGTGCCTGG - Intergenic
933354770 2:81197231-81197253 TTGGAGTCTGCACCTGATCCTGG + Intergenic
933754433 2:85626858-85626880 CAGGCGCCTGCCACTGTGCCTGG + Intronic
934678592 2:96266565-96266587 GGGGAGGCTGAACCTGTTCCTGG + Intronic
934927695 2:98392987-98393009 CAGGTGCCTGCACCCATGCCTGG - Intronic
936042626 2:109161370-109161392 CAGGAGGCTGCCCCTCTTCCTGG - Intronic
936074721 2:109394456-109394478 CCAGAGCCTGCCCCTGTTCTGGG - Intronic
936369254 2:111889648-111889670 CAGGCGCCTGCCACTGTGCCTGG - Intergenic
936459594 2:112703437-112703459 CAGGTGCATGCCACTGTTCCTGG + Intergenic
936513036 2:113163992-113164014 CAGGTGCCTGCCACTGTGCCTGG + Intronic
936673441 2:114686066-114686088 AAGCAGCCTGCATGTGTTCCAGG - Intronic
936956192 2:118024628-118024650 CAGGAGCATGCCGCTGTGCCTGG - Intergenic
937162615 2:119779472-119779494 CAGGTGCCTGCAACTATGCCCGG - Intronic
937358706 2:121214187-121214209 CAGGAGCCTCGTCCTGTGCCCGG + Intergenic
937411414 2:121680060-121680082 CAGGCGCCTGCCACTGTGCCTGG + Intergenic
937764105 2:125639964-125639986 AAAGAGCCTGGACATGTTCCAGG + Intergenic
938246443 2:129781018-129781040 CAGGAGCCAGCTGCTGGTCCAGG - Intergenic
938734901 2:134176966-134176988 CAGAAACAAGCACCTGTTCCTGG - Intronic
938828643 2:135032212-135032234 CAGGCGCCTGCCACTGTGCCTGG - Intronic
939324147 2:140666134-140666156 CAGGTGCCTGCCACTGTGCCCGG + Intronic
939556455 2:143679982-143680004 CAAGAGCCTGCAAGTGTTTCTGG + Intronic
942444133 2:176067132-176067154 TAGCCGCCTGCCCCTGTTCCCGG + Intergenic
943101707 2:183494709-183494731 CAGGTGCCTGCCACTGTGCCTGG - Intergenic
943431560 2:187809262-187809284 CATGAGTCTGCACCTGGCCCAGG - Intergenic
944448727 2:199819265-199819287 CAGGACCCTGCCCCAGTGCCAGG + Exonic
944687509 2:202130772-202130794 CAGGTGCCTGCCACTGTGCCTGG - Intronic
944729843 2:202504820-202504842 CAGGTGCCTGCCCCCGTGCCTGG + Intronic
944778537 2:202994310-202994332 CAGGCGCCTGCCCCTGCGCCTGG + Intronic
945084350 2:206116440-206116462 CTGCAGCCTGCACGTGGTCCTGG - Intronic
945768135 2:214005345-214005367 CAAGATCCTGCCCGTGTTCCAGG + Intronic
947004873 2:225499453-225499475 CAGGCGCCCGCTACTGTTCCCGG + Intronic
947974657 2:234355300-234355322 CATGAGCCTGCAGCTCATCCAGG - Intergenic
948074260 2:235153472-235153494 CAGGAGGCTGGCCCTGTCCCTGG - Intergenic
948185689 2:236019623-236019645 CAGCAGCCTGCACCTGGACGGGG + Intronic
948303162 2:236924439-236924461 CAGGAGCCTGCCACTATGCCCGG + Intergenic
948850148 2:240701815-240701837 CCGGAGCCTGCGCCACTTCCAGG - Intergenic
948883742 2:240872975-240872997 CAGGAGCAGGCACTTGTACCTGG - Exonic
1168942010 20:1720776-1720798 CAGGTGCCTGCCACTGTGCCAGG - Intergenic
1169218678 20:3807997-3808019 CAGGAGCCTGGGCCTGGGCCTGG + Intergenic
1170577417 20:17674980-17675002 CAGGTGCTTGCACCAGTTCTGGG - Intronic
1171196775 20:23206053-23206075 CAGGCTCCTGCACCTGGTCAGGG - Intergenic
1171546314 20:26004557-26004579 CAGGTGCCTGCCACTGTGCCTGG - Intergenic
1172145965 20:32758720-32758742 CAGGCGCCTGCCACTGTGCCCGG + Intergenic
1172969301 20:38861817-38861839 CAGGAGCCTGCCACCGTGCCCGG + Intronic
1173143346 20:40503838-40503860 CAGGAGCCTGCATCTGTGGATGG + Intergenic
1173364213 20:42370316-42370338 CAGGAGTCAGTACCTGTGCCAGG + Intronic
1173463796 20:43264965-43264987 CAGGTGCCTGCCACTGTGCCTGG - Intergenic
1175116110 20:56683648-56683670 CAGGATTCTGCACCTGAGCCAGG - Intergenic
1175722158 20:61294016-61294038 CCGGGGCCTTCACCTGTCCCGGG - Intronic
1175862793 20:62159199-62159221 CAGGAGACAGCACCTACTCCAGG + Intronic
1175985853 20:62763873-62763895 CAGGAGCCTGCCATGGTTCCTGG + Intergenic
1176030675 20:63009758-63009780 CAGGAGACAGCACCTGTGGCCGG + Intergenic
1176122804 20:63461729-63461751 CAGGAGGCTGCACCTACCCCAGG + Intronic
1176550715 21:8219627-8219649 CCGGCGCCTGCACGTGTCCCGGG + Intergenic
1176577557 21:8446897-8446919 CCGGCGCCTGCACGTGTCCCGGG + Intergenic
1177372215 21:20218724-20218746 CAGGTGCCTGTAGCTCTTCCAGG - Intergenic
1178695295 21:34787620-34787642 TGGGAGCCTGCGCCTTTTCCAGG + Intergenic
1178865484 21:36323523-36323545 CAGGAAGCTACACCTGTTTCTGG - Intronic
1178995786 21:37398199-37398221 CAGGTGCCTGCCACTGTGCCAGG - Intronic
1179205713 21:39275887-39275909 CAGGCGCCTGCCACTGTGCCCGG - Intronic
1179632699 21:42688566-42688588 CAGTGACCTGCCCCTGTTCCTGG + Intronic
1179954327 21:44729769-44729791 CAGAAGGCGGCACGTGTTCCAGG + Intergenic
1179980112 21:44891313-44891335 CAGAAGCCATCACCTGTCCCAGG + Intronic
1180684110 22:17651522-17651544 CAGGTGCCTGCCACTGTGCCCGG + Intronic
1181021182 22:20104070-20104092 CTGGAGCCTCCACCTGTCCCTGG + Intronic
1181298203 22:21859333-21859355 CAGGTGCCTGCCACTGTACCTGG - Intronic
1181768468 22:25109250-25109272 CAGGTGCCTGCCACTGTGCCCGG + Intronic
1182206300 22:28630974-28630996 CAGGTGCATGCCACTGTTCCTGG - Intronic
1182243568 22:28936514-28936536 CAGGAGCCTGCTGCTCTGCCAGG - Intronic
1183291459 22:37004216-37004238 CAGGAGGCAGCCCCTGTGCCAGG - Intronic
1184476090 22:44722213-44722235 CTGGAGCCTGGCCCTGCTCCTGG - Intronic
1184663968 22:45977858-45977880 CAGGAGCCTCCCCCAGTGCCGGG - Intergenic
1184710601 22:46247301-46247323 CAGCAGCCTGCACCTCTGCAGGG + Intronic
1184795926 22:46732320-46732342 CAGGAACCTGTAGCTGGTCCAGG - Intronic
1184974487 22:48051557-48051579 ATGGCGCCCGCACCTGTTCCTGG + Intergenic
1185238754 22:49729341-49729363 CTGGAGCCCACACCTGCTCCCGG - Intergenic
1203255616 22_KI270733v1_random:135970-135992 CCGGCGCCTGCACGTGTCCCGGG + Intergenic
1203255966 22_KI270733v1_random:138122-138144 CCGGCGCCTGCACGTGTCCCGGG + Intergenic
949931558 3:9082649-9082671 CAGGAGGCTGCAGCTGCTCAGGG - Intronic
950148007 3:10665489-10665511 CAGGAGGCAGCCCCTATTCCAGG - Intronic
950185052 3:10939679-10939701 CAGGTGCAGTCACCTGTTCCCGG + Exonic
950361180 3:12450515-12450537 CAGGAGCCTGACCATGGTCCAGG + Intergenic
950427919 3:12934659-12934681 CAGGAGCCTGCACGTTCCCCAGG + Intronic
951432922 3:22628936-22628958 CAGGAGCCTTAACCTGTTTGGGG + Intergenic
951905934 3:27707646-27707668 CAGGTGCCTGCCACTGTGCCTGG + Intergenic
953313246 3:41901320-41901342 CAGGCGCCTGCCACTGTGCCTGG + Intronic
953434568 3:42868265-42868287 CAGGAGCCTTCACATCTCCCTGG + Intronic
953686598 3:45082949-45082971 CAGGAGCCAGCAACTTGTCCAGG + Exonic
953912556 3:46900255-46900277 CCAGAGCCTGCATCTGTTCCTGG - Intronic
953947170 3:47159830-47159852 CAGGCGCCTGCCACTGTGCCTGG - Intronic
954107914 3:48419243-48419265 CAGGAACCTGCACCTTTTCCAGG - Exonic
954454116 3:50587829-50587851 CAGGAGGCTGCAACTTGTCCAGG + Intergenic
954598784 3:51851731-51851753 CAAGAACCTGCAACGGTTCCTGG - Intergenic
955372443 3:58364567-58364589 CAGGTGCCTGCCACTGTTCCCGG - Intronic
956662456 3:71612651-71612673 CAGGCGCCTGCCACTGTGCCTGG - Intergenic
957638374 3:82815859-82815881 TAGGTGACTGCAGCTGTTCCTGG + Intergenic
959476655 3:106820950-106820972 CAGGAGGCTTCAGCTGTGCCTGG - Intergenic
960716949 3:120585263-120585285 CAGGTGCCTGCCACTGTGCCCGG - Intergenic
960951779 3:123003689-123003711 CAGGCGCCTGCCACTGTGCCTGG - Intronic
961494857 3:127284214-127284236 CAGGAGCCACCTCCTGCTCCTGG - Intergenic
961677349 3:128575885-128575907 CAGGAGCCTCCAGCTCTTTCTGG - Exonic
963409328 3:144908181-144908203 CAAGAACCTGCAACTGTCCCTGG + Intergenic
965656208 3:170988469-170988491 CAGGACCCTGCTCCTGGACCTGG + Intergenic
965678398 3:171224119-171224141 CATGAGCCTGCAGCTGCTGCTGG + Intronic
966156540 3:176922610-176922632 CAGGAACCTGCCACTGTGCCTGG - Intergenic
966396132 3:179505134-179505156 AAGGAGCCAGCACCTGTTACAGG + Intergenic
966959054 3:184915144-184915166 CAGGAGCTATCACCTGTTGCAGG + Intronic
967096495 3:186181588-186181610 CAGGTGCCTGCCACTGTGCCTGG - Intronic
967370169 3:188735522-188735544 CAGGAGCCTGCCACCGTGCCCGG + Intronic
968226388 3:196974979-196975001 AAGGAGCATGCACTTTTTCCTGG + Intergenic
969585338 4:8088178-8088200 CAGCAGCGCGCACCTGTCCCAGG - Exonic
969631760 4:8343157-8343179 CAGGAGCCTGCCTCTGTACCAGG - Intergenic
969757863 4:9161867-9161889 CAGGAGCCTGCTTGTGCTCCCGG - Intergenic
970039688 4:11781928-11781950 CAGGTGCCTGCCCCTGCACCTGG - Intergenic
970923438 4:21422341-21422363 CAGGTGCCTGCAACTATGCCTGG + Intronic
971209614 4:24603103-24603125 CAAGAGCCTGCAGTTGTTCCAGG + Intergenic
971985849 4:33822769-33822791 CAGGAGCCTGCAACCATGCCAGG - Intergenic
972003808 4:34072893-34072915 CAGGCGCCTGCCACTGTGCCTGG - Intergenic
972588818 4:40464746-40464768 CAGGTGCCTGCCACTGTACCCGG - Intronic
975246733 4:72129032-72129054 CAGGTGCCTGGATCAGTTCCTGG - Intronic
976090788 4:81455293-81455315 CAGGTGCATGCAACTGTGCCTGG - Intronic
978324374 4:107535450-107535472 CAGAGACCTGCACCTGTTCCTGG - Intergenic
978665273 4:111174605-111174627 CAGCAGCTTGGACCTGTTGCAGG - Intergenic
981615025 4:146637341-146637363 CCAGTGCCTGCACCTGCTCCCGG + Intergenic
981910263 4:149971575-149971597 CAGGTGCATGCCACTGTTCCTGG - Intergenic
983172608 4:164552717-164552739 CATGAAACTGCACCTGTTCTTGG + Intergenic
984093711 4:175408480-175408502 CAGCAGCCTGAACCTGATGCAGG - Intergenic
984913548 4:184699185-184699207 CAGGCGCCTGCCACTGTGCCCGG - Intronic
985419127 4:189765617-189765639 CAGGGGTCTGCACCTGCCCCTGG + Intergenic
985677349 5:1238863-1238885 CAGGAGCCAGCGCCTGCTCCAGG + Intronic
987431193 5:17835686-17835708 CAGGAGCCCGCCACTGTGCCTGG + Intergenic
987881277 5:23749415-23749437 CATGGGCCTGCAGCTTTTCCAGG + Intergenic
988565408 5:32316792-32316814 CAGGTGCCTGCCACTGTGCCTGG + Intergenic
989177141 5:38539101-38539123 CAGGCGCCTGCCACTGTGCCTGG + Intronic
991724284 5:69520441-69520463 CAGGCGCCTGCCACTGTGCCCGG + Intronic
992736097 5:79723294-79723316 CAGGTGCCTGCCACTGCTCCCGG - Intronic
993309743 5:86314141-86314163 GAGGAGTCTGCAGCTTTTCCAGG - Intergenic
993593629 5:89826201-89826223 CAGGTGCCTGCCACTGTGCCCGG + Intergenic
995886418 5:116899618-116899640 CAGGTGCCTGCTGCTGTGCCTGG + Intergenic
996762866 5:127003605-127003627 CAGGCGCCTGCAACCGTGCCCGG - Intronic
996774769 5:127121374-127121396 CAGGGACCTGCACCTGGCCCAGG + Intergenic
997326829 5:133028523-133028545 CAGGCGCCTGCCCCCGTGCCTGG + Intergenic
997562660 5:134861930-134861952 CAGGTGCCTGCCACTGTTCCTGG + Intergenic
998862591 5:146458982-146459004 CCTGAGCCTGAACCTGTGCCTGG - Exonic
999258043 5:150220702-150220724 CAAGAGCCTGCCCCTGGGCCTGG + Intronic
1001031636 5:168267529-168267551 CAGGAGCCTGCCCCCATGCCCGG + Intergenic
1001466164 5:171968313-171968335 CAGGTGCCTGCCACTGTGCCCGG - Intronic
1002240680 5:177837227-177837249 CAGGTGCCTGCCACTGTGCCTGG - Intergenic
1002507914 5:179693001-179693023 CAGGCGCCTGCCACTGTGCCCGG - Intronic
1002640210 5:180627165-180627187 CAGGTGCCTGCCCCTGGTGCTGG + Intronic
1002741272 5:181437160-181437182 CAGGGGCCTGGGCCTGCTCCGGG - Intergenic
1003015131 6:2462108-2462130 CAGGAGACTTCACTTGTGCCCGG - Intergenic
1003458325 6:6305504-6305526 CACGAGCGTTCACCTGTTCAAGG - Exonic
1003837619 6:10088436-10088458 CAGGTGCCTGCCACTGTGCCCGG - Intronic
1004084207 6:12428689-12428711 CAGGTGCCTGCCACTGTGCCTGG + Intergenic
1004086036 6:12450215-12450237 CTGGGGCCTGTACCTGTTCTTGG - Intergenic
1004355042 6:14923370-14923392 CAGGAGCCTGCCCCTCTGGCTGG - Intergenic
1004473583 6:15950496-15950518 CAGGTGCCAGCATCTGCTCCTGG - Intergenic
1005710567 6:28500258-28500280 CAGGAACCTGCAGTTGCTCCAGG - Intergenic
1005955557 6:30661038-30661060 CAGGTGCCTGCCACTGTGCCTGG + Intronic
1006396970 6:33793794-33793816 CGGGAACCTGCACCTGCTCTGGG + Intergenic
1006836836 6:37004221-37004243 CTGGAGCGTGAAGCTGTTCCAGG + Intergenic
1007660805 6:43484866-43484888 CAGGTGCCTGCCACTGTGCCTGG + Intronic
1009024445 6:57981946-57981968 CAGGAGCCTGCCACTGTGCCCGG + Intergenic
1009660720 6:66607121-66607143 CAGCAGCCTGAACCTGTTGCAGG + Intergenic
1009967585 6:70593514-70593536 CAGGTGCCTGCAGCTTTTCCAGG - Intergenic
1011641630 6:89421132-89421154 CAGGAGCCTGCCACTGAACCTGG - Intergenic
1011670002 6:89674360-89674382 CAGGAGGCTGCCCCAGTACCTGG + Exonic
1013516208 6:110888452-110888474 CAGGCGCCTGCCACTGTGCCCGG + Intronic
1013638286 6:112049146-112049168 CAGGAGGCTGCCCCAGTACCAGG - Intergenic
1013806631 6:114003295-114003317 CAGGCGCCTGCCACTGTGCCCGG - Intronic
1013918930 6:115376536-115376558 CAGGAGCCTGAATCTGATCAAGG - Intergenic
1016112457 6:140242059-140242081 CAGGCGCCTGCCACTGTGCCCGG - Intergenic
1017894850 6:158670638-158670660 CAGGCGCCTGCCACTGTGCCCGG - Intronic
1018041411 6:159926258-159926280 CAGGCGCCTGCCACTGTGCCTGG + Intergenic
1018558333 6:165073598-165073620 CAGGATCCTGCACCAGCCCCGGG - Intergenic
1018756871 6:166857568-166857590 CAGGAGCATGGGCCTGATCCAGG - Intronic
1018790197 6:167142379-167142401 CCAGCGCCTGCACCTGCTCCTGG + Intergenic
1019019191 6:168903090-168903112 TAGGGGCCAGCACCTGCTCCTGG + Intergenic
1019246387 6:170712857-170712879 CAGGGGCCTGGGCCTGCTCCGGG - Intergenic
1019272964 7:160750-160772 CACGAGGCCGCACCTGTTCCTGG + Intergenic
1020141056 7:5612034-5612056 CAGGAGCATGCCACTGTGCCCGG - Intergenic
1021615731 7:22500817-22500839 CAGGCGCCTGCCACTGTGCCCGG + Intronic
1021853375 7:24830266-24830288 CATGTGCCTGCCACTGTTCCAGG - Intronic
1021860500 7:24901182-24901204 CAGGCGCCTGCCACTGTGCCCGG - Intronic
1022178349 7:27894135-27894157 CAGGAGCTTACACCTGTTGGAGG - Intronic
1022464597 7:30645074-30645096 CAGGTGCCTGCCACTGTGCCTGG + Intergenic
1022510573 7:30932718-30932740 CAGGAGCCAGCAGCTTCTCCTGG + Intergenic
1022677935 7:32517446-32517468 CAGGTGCCTGCCACTGTGCCTGG + Intronic
1023529165 7:41135774-41135796 ATGGAGCCAGCACCTGTGCCAGG - Intergenic
1023952725 7:44859738-44859760 CAGGTGCCTGCCACTGTGCCTGG + Intergenic
1024101346 7:46035898-46035920 CAGGTGCCTGCCACTGTGCCTGG + Intergenic
1024525878 7:50348941-50348963 CTGGAGACTGGACCTGTGCCAGG - Intronic
1025847407 7:65212752-65212774 GAGGATCCTGCACATGCTCCAGG - Intergenic
1025897651 7:65718642-65718664 GAGGATCCTGCACATGCTCCAGG - Intergenic
1026361987 7:69610543-69610565 CAGTTTCCTGCACGTGTTCCCGG + Intronic
1026818925 7:73533612-73533634 CAGGTGCCTGCCACTGTGCCTGG - Intergenic
1027421308 7:78020041-78020063 CAGCTGCCTGCCCCTGTCCCCGG - Intronic
1028376768 7:90153818-90153840 CAGGCGCCTGCCACTGTGCCCGG - Intergenic
1028606800 7:92663996-92664018 CAGGCGCCTGCCCCCGTGCCCGG - Intronic
1028969343 7:96840236-96840258 CAAGAGCCTGATCCTGTGCCTGG + Intergenic
1029350575 7:100010312-100010334 CAGGTGCCTGCCACTGTGCCCGG - Intergenic
1029622536 7:101699029-101699051 TGGGAGCCTGCATCTGCTCCAGG - Intergenic
1030305022 7:108008946-108008968 AAGCAGCCTCCACCAGTTCCAGG - Intergenic
1032117209 7:129127264-129127286 CTGGAGCATGGACCTGTCCCTGG + Intergenic
1034282282 7:149862642-149862664 CAGGAGCTTGCACCCCTGCCAGG + Intronic
1034595968 7:152192397-152192419 CAGGTGCCTGCCACTGTGCCCGG - Intronic
1034751526 7:153573205-153573227 CAGGAGCCCGCCACTGTGCCAGG + Intergenic
1035288477 7:157821687-157821709 CTGGAGTCTGCACCTGTGGCCGG + Intronic
1035501685 8:94832-94854 CAGGGGCCTGGGCCTGCTCCGGG + Intergenic
1035750411 8:1992139-1992161 CAGGAACCTGCCCCTCTTCCTGG - Intronic
1035996757 8:4555710-4555732 CAGGAGCCTGCACCCTTTCAGGG + Intronic
1036245646 8:7114375-7114397 CAGGTGCCTGCCTCTGTGCCTGG + Intergenic
1036591119 8:10169146-10169168 CAGGAGTCTGCCCCTGTCTCTGG - Intronic
1037497118 8:19450560-19450582 AAGGAGCCTGCCACAGTTCCAGG + Intronic
1037967345 8:23145089-23145111 CAGGAGACTGCTTCTTTTCCAGG - Exonic
1039069316 8:33635309-33635331 CAGGTGCCTGCCACTGTGCCTGG + Intergenic
1039897946 8:41729733-41729755 CAGCAGCCTCCATCTGTTCCCGG + Intronic
1040325230 8:46338256-46338278 CAGGAGTCCCCACCTGTCCCGGG + Intergenic
1041739156 8:61139869-61139891 CACGAGGCTACACCTGGTCCTGG + Intronic
1042199960 8:66271861-66271883 CAGGAGCCCGCCACTGCTCCCGG + Intergenic
1043372030 8:79606169-79606191 CAGGAGCCTGCCACTATGCCCGG + Intergenic
1043698919 8:83258976-83258998 CAGGTGCCTGCCACTGTGCCAGG + Intergenic
1044212419 8:89565219-89565241 CAGGTGCCTGCCACTGTGCCTGG - Intergenic
1044596332 8:93962416-93962438 CAGGTGCCTGCCACTGTGCCGGG + Intergenic
1045278854 8:100731033-100731055 CAGGTGCCTGCTGCTGTGCCTGG - Intergenic
1046064004 8:109175336-109175358 CAGCAGCCTGAACCTGTTGCAGG + Intergenic
1046257634 8:111721922-111721944 CAAGAGCTTGCAGCTTTTCCAGG + Intergenic
1047170814 8:122490614-122490636 CAGGTGCCTGCCACTGTGCCTGG - Intergenic
1048382569 8:133880290-133880312 CAGGAGCCCGCCGCTGCTCCCGG - Intergenic
1048886698 8:138914795-138914817 CCCGGGCCTGCACCTGTTCATGG - Intergenic
1048899549 8:139024344-139024366 CAGGGGCCTCCACCTGCACCAGG - Intergenic
1049140383 8:140949411-140949433 TAGGAGGCTGCAGCTGTACCTGG - Intronic
1049228273 8:141468060-141468082 CAGGACCCAGCTCCTGTCCCAGG + Intergenic
1049233748 8:141497486-141497508 CAGGAGCCTGTTCCTGCCCCAGG - Intergenic
1049317160 8:141975444-141975466 AGGGGGCCTGCACCTGCTCCTGG - Intergenic
1049653715 8:143788655-143788677 CAGGAACCTGCTCCTGTGGCTGG - Intergenic
1049950984 9:643843-643865 CAGGTGCCTGCTACTGTGCCCGG + Intronic
1050285411 9:4096867-4096889 CAGGCGCCTGCCACTGTGCCTGG - Intronic
1051131990 9:13872938-13872960 CAGGCGCCTGCCACTGCTCCTGG + Intergenic
1051293861 9:15574285-15574307 CAGGTGCCTGCCACTGTGCCTGG + Intronic
1051618256 9:19027426-19027448 CAGTGGCCTCCACCAGTTCCTGG - Intronic
1054784962 9:69201510-69201532 CAGGAGCCAGCATCTGATCAAGG - Intronic
1055007522 9:71525476-71525498 CTGGAGCCCACACCTGCTCCCGG - Intergenic
1055050170 9:71971829-71971851 CAGGCGCCTGCCACTGTGCCCGG - Intronic
1057117749 9:92541501-92541523 CAGGTGCCTGCCACTGTGCCTGG + Intronic
1057255599 9:93544744-93544766 AAGGAACCTGTTCCTGTTCCAGG + Intronic
1058909228 9:109505890-109505912 CAGGAGCCTGCCGCTATGCCCGG + Intergenic
1059089561 9:111341251-111341273 CAGGCGCCTGCCACTGTGCCTGG - Intergenic
1059936934 9:119321071-119321093 CAGGCGCCTGCCACTGTGCCCGG + Intronic
1060772046 9:126339070-126339092 GAGGAGACTGCAGCTGTGCCAGG + Intronic
1061105374 9:128526162-128526184 CAGGTGCCTGCCACTGTGCCTGG + Intronic
1061484716 9:130914460-130914482 CAGGACCCTGCCCCTCCTCCAGG - Intronic
1061805268 9:133134199-133134221 CTGGAGGCTGCACCTATGCCTGG + Intronic
1061913084 9:133735140-133735162 CTGGAGCCAGCACCTCCTCCTGG + Intronic
1062095696 9:134702045-134702067 CAGGAGCCTGTAGGGGTTCCAGG + Intronic
1062185269 9:135214879-135214901 CCGGATCCAGCACCTTTTCCAGG + Intergenic
1062536048 9:137021592-137021614 CAGGAGCCAGCAGCAGCTCCTGG + Exonic
1203472013 Un_GL000220v1:119105-119127 CCGGCGCCTGCACGTGTCCCGGG + Intergenic
1203607151 Un_KI270748v1:68240-68262 CAGGGGCCTGGGCCTGCTCCGGG - Intergenic
1185698973 X:2216084-2216106 CAGGTGCCTGCAACCGTGCCTGG + Intergenic
1190120366 X:47654347-47654369 CAGGCGCCTGCCACCGTTCCCGG + Intronic
1192415807 X:70979561-70979583 CAGTAGCATGCTCCTCTTCCCGG - Intergenic
1192746695 X:73946061-73946083 CAGGCGCCTGCCACTGTGCCCGG + Intergenic
1193747812 X:85303700-85303722 CAGGAACCTGCAACTGATACAGG + Intronic
1193888839 X:87017555-87017577 TGGGAGCCAGGACCTGTTCCTGG - Intergenic
1193904457 X:87225628-87225650 CAGCAGACTGGACCTGTTGCAGG - Intergenic
1194627508 X:96242825-96242847 CAGCAGCAAGCACCTGTTCCTGG + Intergenic
1196836635 X:119819985-119820007 CAGGAGCCCGCCACTGTGCCTGG + Intergenic
1196852927 X:119955893-119955915 CAGGTGCATGCAACTGTGCCCGG + Intergenic
1197513487 X:127398210-127398232 CATGAGCTGGCACTTGTTCCGGG - Intergenic
1197595128 X:128455093-128455115 CAGGACCCTGGGCCTGGTCCAGG + Intergenic
1197929195 X:131678146-131678168 GAGAAGCCTGCTCCTGTTGCGGG + Intergenic
1198588586 X:138150117-138150139 CTGGTGCCTGCAGCTTTTCCAGG - Intergenic
1199826889 X:151509299-151509321 CCAGATCCTGGACCTGTTCCTGG + Intergenic
1202058383 Y:20859839-20859861 CAGGGGCCTGCCCATGTACCAGG + Intergenic
1202065563 Y:20935964-20935986 CAGGAGCCTGTACCAGTTACTGG - Intergenic
1202381046 Y:24276747-24276769 CAGGAGGCTGGAGCTGGTCCTGG - Intergenic
1202489739 Y:25393379-25393401 CAGGAGGCTGGAGCTGGTCCTGG + Intergenic