ID: 1141920506

View in Genome Browser
Species Human (GRCh38)
Location 16:87132599-87132621
Sequence CAAGAAATGTAGCCGGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 87}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141920506_1141920511 6 Left 1141920506 16:87132599-87132621 CCAGCAGCCGGCTACATTTCTTG 0: 1
1: 0
2: 1
3: 8
4: 87
Right 1141920511 16:87132628-87132650 TTTCCAGGAAGACTTGCCAGCGG 0: 1
1: 0
2: 4
3: 38
4: 305
1141920506_1141920517 29 Left 1141920506 16:87132599-87132621 CCAGCAGCCGGCTACATTTCTTG 0: 1
1: 0
2: 1
3: 8
4: 87
Right 1141920517 16:87132651-87132673 TGCCCGTGCAGGGCCCACCTGGG 0: 1
1: 0
2: 2
3: 9
4: 166
1141920506_1141920509 -9 Left 1141920506 16:87132599-87132621 CCAGCAGCCGGCTACATTTCTTG 0: 1
1: 0
2: 1
3: 8
4: 87
Right 1141920509 16:87132613-87132635 CATTTCTTGGACACCTTTCCAGG 0: 1
1: 0
2: 0
3: 22
4: 219
1141920506_1141920516 28 Left 1141920506 16:87132599-87132621 CCAGCAGCCGGCTACATTTCTTG 0: 1
1: 0
2: 1
3: 8
4: 87
Right 1141920516 16:87132650-87132672 GTGCCCGTGCAGGGCCCACCTGG 0: 1
1: 0
2: 2
3: 14
4: 166
1141920506_1141920514 19 Left 1141920506 16:87132599-87132621 CCAGCAGCCGGCTACATTTCTTG 0: 1
1: 0
2: 1
3: 8
4: 87
Right 1141920514 16:87132641-87132663 TTGCCAGCGGTGCCCGTGCAGGG No data
1141920506_1141920513 18 Left 1141920506 16:87132599-87132621 CCAGCAGCCGGCTACATTTCTTG 0: 1
1: 0
2: 1
3: 8
4: 87
Right 1141920513 16:87132640-87132662 CTTGCCAGCGGTGCCCGTGCAGG 0: 1
1: 0
2: 2
3: 3
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141920506 Original CRISPR CAAGAAATGTAGCCGGCTGC TGG (reversed) Intronic
904156146 1:28484811-28484833 CAAAAAATTTAGCCGGGTGGTGG + Intronic
908170671 1:61501512-61501534 CAGGAAGTGTAGCCAGCTGGTGG + Intergenic
908354981 1:63320098-63320120 CAACAAATGGAACCGGCAGCTGG + Intergenic
912948579 1:114105151-114105173 CAACAACTGTAGCCTCCTGCTGG - Intronic
915366508 1:155319859-155319881 CAACAAATGCAGCTGGCTGGTGG + Exonic
915441881 1:155950661-155950683 AAAGAAATGTAGATGGGTGCAGG - Intronic
918697694 1:187563862-187563884 CAACAAATGCAGCTGGCTGGTGG + Intergenic
919961422 1:202473871-202473893 CAAGAAAGGTAAGTGGCTGCTGG - Intronic
921071307 1:211660443-211660465 CAACAAATGCAGCTGGCTGGTGG - Intronic
1063383267 10:5600065-5600087 CCAGGAATGCCGCCGGCTGCAGG - Intergenic
1066388686 10:34961839-34961861 TAAGAAAATTAGCCGGGTGCAGG + Intergenic
1071732890 10:88266845-88266867 TGAGAAAGGTAGCTGGCTGCTGG + Intergenic
1076170954 10:128319591-128319613 TCAGAAGTGTAGCCGGCTGGAGG - Intergenic
1078326752 11:10387477-10387499 CAAAAAATGTGGCCAGCCGCTGG + Intronic
1083737122 11:64687711-64687733 CAAGAAATGAAGACGGCTCAGGG + Intronic
1084166567 11:67377561-67377583 CAAGAAGTGTGGCTGGCTGGGGG + Intronic
1086062518 11:82714561-82714583 CAGGAAACGCAGCCTGCTGCAGG + Intergenic
1086322132 11:85662403-85662425 CAGGAAATGTGGCCAGCAGCTGG + Exonic
1089722822 11:120444844-120444866 CAAGAACTGTAGATGGTTGCTGG + Intronic
1096698234 12:53364651-53364673 CAAAAAATTTAGCCGGCGGCCGG - Intergenic
1100242220 12:92721248-92721270 CCAGAAATGTCTCTGGCTGCTGG - Intergenic
1102062597 12:109944944-109944966 CGAGAAAATTAGCTGGCTGCTGG - Intronic
1103451894 12:121035060-121035082 CAAGAAAAGTAGCCTTCTGGGGG - Intronic
1103721840 12:122979423-122979445 CAAGAAGTGCAGTAGGCTGCGGG - Exonic
1104004843 12:124884734-124884756 CAAGAAATGCCGAGGGCTGCTGG + Intergenic
1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG + Intergenic
1105878710 13:24584329-24584351 GATGAAATGTGGCTGGCTGCCGG - Intergenic
1105921134 13:24964733-24964755 GATGAAATGTGGCTGGCTGCCGG + Intergenic
1107737014 13:43409870-43409892 CAAGGAATGTAGTCGGCTGGTGG + Intronic
1110301895 13:73938399-73938421 AAAGAAATATAGACGGGTGCAGG - Intronic
1111090388 13:83438797-83438819 CAAGAAATGTACATGGCTTCTGG - Intergenic
1115530118 14:34319274-34319296 CCAGAACTGTAGCAGCCTGCCGG + Intronic
1115951362 14:38726072-38726094 CCAGAAATGTAGAAGGATGCAGG - Intergenic
1118422571 14:65623043-65623065 TAAAAAATCTAGCTGGCTGCAGG - Intronic
1119331131 14:73794697-73794719 CAAGAAATGTCCCAGGATGCTGG + Intergenic
1119372794 14:74161950-74161972 GAAGAAATGTAGCCTGCTGTTGG + Intronic
1125854931 15:42939556-42939578 CAATAAATGCAGCTGGCTGCTGG - Intergenic
1125875469 15:43140398-43140420 CAACAAATGCAGCTGGCTGGTGG - Intronic
1129989002 15:79945310-79945332 CAACAAATGCAGCTGGCTGGTGG + Intergenic
1130038203 15:80380592-80380614 TAAGAAATCTAGCAGGCTGGTGG + Intronic
1130203730 15:81856383-81856405 CATGAAATGTTGCAGGCAGCTGG + Intergenic
1135540682 16:23327944-23327966 CAAGACATGTGTCAGGCTGCTGG + Intronic
1135838108 16:25846377-25846399 TAAAAAATGTAGCTGGGTGCAGG + Intronic
1138605820 16:58088200-58088222 GAAGAAATGGAGGCGGCGGCGGG + Intergenic
1139965227 16:70741642-70741664 CAAGAAGTGTGACTGGCTGCAGG + Intronic
1141920506 16:87132599-87132621 CAAGAAATGTAGCCGGCTGCTGG - Intronic
1142004327 16:87682142-87682164 CAGGAAATGAAGCAAGCTGCTGG - Intronic
1148214434 17:45826677-45826699 CAAGAAATGTCGCAGGGGGCCGG + Intronic
1153505299 18:5790595-5790617 CAAGGAATGGAGAGGGCTGCTGG + Intergenic
1153809952 18:8743600-8743622 CAAGAAATGTAGATGGCCTCTGG - Intronic
1157265505 18:46216465-46216487 GAAGAAATATAACCTGCTGCAGG + Exonic
1162136796 19:8560328-8560350 CAAAAAAAGTAGCCGGGTGTGGG + Intronic
1163031552 19:14547813-14547835 AAACAAAAGTAGCCGGCTGTAGG - Intronic
931871235 2:66462383-66462405 CAAGACATGTGGGAGGCTGCAGG - Intronic
935874233 2:107488658-107488680 CAAGAAATTTAGCCTGGTGGAGG - Intergenic
936522183 2:113218242-113218264 GAAGAAATGTAGCCCCCAGCCGG - Exonic
938386164 2:130868873-130868895 CAAGGAATGTAGGCGGCCACTGG - Intronic
941407784 2:165112894-165112916 CAAGAAATCTAGCCAGCACCAGG + Exonic
943778014 2:191788525-191788547 CCAGAAATGAGGCAGGCTGCAGG + Intergenic
945649240 2:212538514-212538536 CAAAAAATGAAGCCGGCGACAGG - Exonic
1175328160 20:58143933-58143955 GAAGAAAGGAAGCCTGCTGCTGG - Intergenic
1179037646 21:37773300-37773322 CAAGACATGTAGCCAGTTGACGG - Intronic
953279423 3:41539335-41539357 CAGTAAATGTAGCCTGCTGTCGG - Intronic
963827208 3:149969509-149969531 CAAGAATTGTAGTCCACTGCGGG + Intronic
965751165 3:171976324-171976346 AAAAAAATGTAGACAGCTGCGGG + Intergenic
976889413 4:90028420-90028442 AAAGAAATGGAGCTGGCTGAGGG + Intergenic
978124768 4:105122538-105122560 CAAGGAATGTGGCAGGCTACTGG + Intergenic
983459868 4:168014740-168014762 CAAGGAATGCAGCCGGAAGCTGG - Intergenic
991410162 5:66337920-66337942 CAAGAGATGTGGCGGGCTGGTGG + Intergenic
995198391 5:109398921-109398943 AAAGAAATGGGGCCGGGTGCAGG + Intronic
998077559 5:139248775-139248797 CAGGAAATGTGGCTTGCTGCTGG + Intronic
999056179 5:148579752-148579774 CAAGGAATGTGGGCTGCTGCTGG - Intronic
1000547174 5:162617869-162617891 CAAGAAATGTGGGCAGCTTCTGG - Intergenic
1007207038 6:40161162-40161184 CAAGAAATGTGGCAGGATCCAGG + Intergenic
1007839374 6:44703083-44703105 CAGGCAATGGAGCCAGCTGCTGG + Intergenic
1010649378 6:78433663-78433685 CAAGAAGTGGAGCCGGTGGCAGG - Intergenic
1011157673 6:84351405-84351427 CAAGGAATGGAGCAGGCTGCTGG + Intergenic
1021334452 7:19381355-19381377 CAATAAATGTATTCAGCTGCTGG - Intergenic
1027261840 7:76470341-76470363 CAACAAATGCAGCTGGCTGGTGG - Exonic
1027313222 7:76968440-76968462 CAACAAATGCAGCTGGCTGGTGG - Intergenic
1032983967 7:137316764-137316786 CCAGCAAATTAGCCGGCTGCCGG + Intronic
1033363655 7:140655592-140655614 CAAGAAATGTTGCGGGATGCAGG - Intronic
1034762618 7:153687306-153687328 CAAGAATTGTAGCCCTCTGTTGG - Intergenic
1034816599 7:154177195-154177217 CAAGAAATATAGGCAGGTGCTGG + Intronic
1040672905 8:49713790-49713812 CATGGAATGTAGCCTGCTGTGGG - Intergenic
1041281892 8:56218942-56218964 CAAGAACTGCAGTTGGCTGCCGG + Intergenic
1044175921 8:89122090-89122112 CAAGAAATGTAAGTGGCAGCAGG + Intergenic
1050116249 9:2266526-2266548 CAAGAAATGCAGCTGGGTGGTGG + Intergenic
1052092723 9:24348791-24348813 CAAGAAATTGAGCAGGCAGCAGG - Intergenic
1055185200 9:73443203-73443225 CCAGAAATGTATCCTGCTGGCGG + Intergenic
1059353653 9:113683594-113683616 CCAGAATTCTAGCAGGCTGCGGG + Intergenic
1185917472 X:4051635-4051657 GAAGAAATGTAACCGTGTGCAGG - Intergenic
1186192987 X:7084209-7084231 CAATAACTGCAGCCAGCTGCTGG - Intronic
1186290501 X:8092391-8092413 CAAGAAATGTAGCAGACTGCTGG - Intergenic
1188852104 X:35144584-35144606 CATGGAATGTAGCCTGCTGCTGG + Intergenic
1189375867 X:40465999-40466021 CAGGAAGTGTAGCCGGCCTCTGG + Intergenic
1201730131 Y:17193610-17193632 CAAGAACTGTATCCTGCTGCAGG + Intergenic