ID: 1141920655

View in Genome Browser
Species Human (GRCh38)
Location 16:87133438-87133460
Sequence AGCCACTTGCGGAAACTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141920647_1141920655 -6 Left 1141920647 16:87133421-87133443 CCACAGCCCACCCTCCCAGCCAC 0: 1
1: 2
2: 15
3: 166
4: 1507
Right 1141920655 16:87133438-87133460 AGCCACTTGCGGAAACTAAAAGG 0: 1
1: 0
2: 1
3: 3
4: 101
1141920646_1141920655 11 Left 1141920646 16:87133404-87133426 CCTGGGTCTGTCAGACTCCACAG 0: 1
1: 2
2: 12
3: 88
4: 563
Right 1141920655 16:87133438-87133460 AGCCACTTGCGGAAACTAAAAGG 0: 1
1: 0
2: 1
3: 3
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141920655 Original CRISPR AGCCACTTGCGGAAACTAAA AGG Intronic
900926842 1:5711306-5711328 AGGCAGTTGTGGAAACTACAAGG - Intergenic
902209963 1:14897864-14897886 AACCGCTTGCTGAAACTAACCGG + Intronic
907093344 1:51750824-51750846 AGCCACTTGCTGGAAATAAAGGG - Intronic
911674680 1:100646401-100646423 AGCTACTTGCGGAAATTAGTGGG + Intergenic
912540745 1:110413021-110413043 AGCAACTTGAGGAAACAAACAGG - Intergenic
915528849 1:156491877-156491899 AGGCACTTGCGGACACCAAGTGG + Intronic
916677702 1:167077541-167077563 TGCCACTGGCAGAACCTAAATGG + Intronic
1069395949 10:67988000-67988022 AGCAACTTGAGAAAACCAAATGG + Intronic
1070387907 10:75942506-75942528 AACCACTTGCGGGAAGTTAAGGG + Intronic
1077382862 11:2253810-2253832 AGCCAATAGTGGAAACTAAATGG + Intergenic
1079942980 11:26705069-26705091 AGTCACTTGAGGAATGTAAAAGG + Intronic
1083207166 11:61159415-61159437 AGCACCTTTGGGAAACTAAACGG + Intronic
1087996675 11:104817627-104817649 AGCAACCTGGGGAAAATAAAGGG + Intergenic
1091572265 12:1697962-1697984 AGCCACTGGCTGACATTAAAGGG - Intronic
1092194707 12:6542210-6542232 AGCCATTTTCAGACACTAAAAGG + Intronic
1093796078 12:23313528-23313550 AGCCACTTCCAGAAACTAGGAGG + Intergenic
1095788018 12:46131942-46131964 AACCACTTGAGGACACTAGAGGG + Intergenic
1097102170 12:56597508-56597530 AGGTACTTGGGGAAACTGAATGG + Exonic
1097491763 12:60280345-60280367 AGCCACTTACTGTAACTGAAAGG - Intergenic
1105817214 13:24047605-24047627 AGCCACTTTGGAAAACTAATAGG - Intronic
1108415876 13:50197812-50197834 AGCCACTTGTGGAAACCCTAGGG + Intronic
1109750252 13:66682839-66682861 AGCTGCCTGCGGAAACTGAATGG - Intronic
1118236376 14:64008790-64008812 AACCACATGCGGAAACAAAGCGG - Intronic
1119809225 14:77502112-77502134 ATACATTTGCGAAAACTAAATGG - Intergenic
1120328165 14:83054901-83054923 ATACACTTGAGGAAATTAAACGG + Intergenic
1123712120 15:22996180-22996202 AAGCACTTGGGGAAACTATATGG - Intronic
1126535405 15:49756737-49756759 AGCCACTGGAGGAAACAGAATGG + Intergenic
1127696688 15:61455907-61455929 AGCCAATAGTGGAAACGAAATGG + Intergenic
1128354253 15:66913475-66913497 AGTCACTTGAAGTAACTAAAAGG - Intergenic
1130855929 15:87840055-87840077 AGCCACTGGGGAAAACCAAACGG + Intergenic
1135837920 16:25844443-25844465 AACCACTAGCAGAAATTAAAAGG - Intronic
1137031896 16:35532041-35532063 AGCCACTTGTGGGAAGTGAAGGG - Intergenic
1141920655 16:87133438-87133460 AGCCACTTGCGGAAACTAAAAGG + Intronic
1147707462 17:42436794-42436816 AGCCACTTGTAAACACTAAAGGG - Intergenic
1152598199 17:81248505-81248527 AGCCGCTTGCGGCAAATAACTGG - Intronic
1155086654 18:22465546-22465568 AGTCACTTGCTGAATCTGAAAGG + Intergenic
1155372760 18:25120668-25120690 AGCCACATGAGTATACTAAAAGG + Intronic
1155995048 18:32322186-32322208 AGCCACTGGCTGAAACTAAAAGG + Intronic
1157570156 18:48706890-48706912 GACCACTTCCGGTAACTAAATGG - Intronic
1158233818 18:55289844-55289866 AGCCAGTTGCAGAAACAATAAGG + Intronic
929634705 2:43506378-43506400 AGCCACTTGAGGCAATAAAAAGG + Intronic
931540522 2:63324903-63324925 AGCCACTTGAGGAAAGCAGAAGG - Intronic
931809886 2:65844606-65844628 AGCCACTTGCCGAAGGTAAGAGG + Intergenic
937981366 2:127618006-127618028 AGGGACTTGCGGGAACTAACAGG - Intronic
938019163 2:127892045-127892067 TCCCACTGGCGGAATCTAAAAGG + Intergenic
939493896 2:142906202-142906224 AGCAAATTGAGTAAACTAAAGGG - Intronic
941537525 2:166741500-166741522 AGCCACTTGAGGAAGGCAAAAGG + Intergenic
945684235 2:212949925-212949947 AACCACTTTGGCAAACTAAAGGG - Intergenic
945977169 2:216280038-216280060 AGCCAGCTGTGGAACCTAAATGG + Intronic
1168782630 20:506665-506687 AGCTACTTGAGGAAAATGAATGG - Intronic
1170919342 20:20661975-20661997 AACAACTTTCAGAAACTAAAGGG + Intronic
1173238168 20:41267236-41267258 AGCCACTTTAGGAATATAAATGG - Intronic
1173986080 20:47262590-47262612 AGCCCTTTGCTGAAAATAAATGG - Intronic
1174817697 20:53700997-53701019 AACCACTGGGGGAAACTAGATGG - Intergenic
1176712126 21:10160079-10160101 AGCAATTTGGGGAAACTATAAGG + Intergenic
1184856494 22:47149319-47149341 AGCCATTTGAGGGAAATAAATGG - Intronic
1185311384 22:50157357-50157379 AGCCACTGGCAATAACTAAAAGG - Intronic
955502699 3:59600835-59600857 AGCCACTGGCTGAGACTAGAAGG + Intergenic
957664999 3:83216506-83216528 ATCCTCTTGAGGACACTAAAGGG - Intergenic
958897892 3:99850041-99850063 AGTTAATTGAGGAAACTAAAAGG - Exonic
964237603 3:154551572-154551594 AACCTCTTGAGGAGACTAAATGG + Intergenic
964921883 3:161907175-161907197 AGATACTTGCTGAAACAAAAAGG - Intergenic
967538632 3:190638203-190638225 AGCCACTTGGGGAAAAAAAAAGG - Intronic
967836128 3:193964626-193964648 AGCCATTTGGGGAAGCTGAACGG + Intergenic
970541311 4:17082589-17082611 AGCTACTTGAAGAAACCAAATGG - Intergenic
970748930 4:19334213-19334235 AGATTCTTGTGGAAACTAAATGG - Intergenic
973016943 4:45152045-45152067 AGCAATTTGGGGAAACTATAAGG - Intergenic
974602507 4:64103754-64103776 AGACATTTACGGAAACAAAAAGG + Intergenic
975311580 4:72909750-72909772 AGCAACCTGAGGAAACTGAATGG - Intergenic
977177176 4:93831663-93831685 AGTCAATTGCATAAACTAAACGG + Intergenic
979831047 4:125303760-125303782 ATCCAGTTGCAGAAACTATAAGG + Intergenic
982666792 4:158274883-158274905 AGCCACTTGTGGATACCTAAGGG - Intergenic
982792404 4:159608211-159608233 AACCACTTACGGAGGCTAAATGG + Intergenic
986319652 5:6619306-6619328 TGCCACTTACTGAAACAAAATGG + Intronic
988933362 5:36059037-36059059 AGGGACTTGCAGAAACTAACAGG + Intronic
994178249 5:96735402-96735424 AGAGACTGGCAGAAACTAAATGG - Intronic
999013708 5:148072430-148072452 AGGCACTGACGGAAACTAAGAGG + Intronic
1003608667 6:7588905-7588927 AACCATTTGGGGAAACTACAAGG + Intergenic
1011351495 6:86428525-86428547 AGCCAGGTGTGGAAACTATAGGG + Intergenic
1020975041 7:14995564-14995586 AGCCACTTAGAGAGACTAAAAGG - Intergenic
1023220808 7:37918904-37918926 AGGCACTTGAGGAGACCAAAAGG - Intronic
1024824957 7:53380568-53380590 TGCCTCTTGCTGTAACTAAAAGG - Intergenic
1028677054 7:93477192-93477214 ACCCAGATGCTGAAACTAAATGG - Intronic
1030917248 7:115330689-115330711 AGCCAATTGGGTAAACCAAAAGG + Intergenic
1032379470 7:131461984-131462006 AGCCACTCAAGGAAACAAAATGG + Intronic
1033022432 7:137739842-137739864 TGCCACTTGCAGAATCGAAATGG + Intronic
1035242685 7:157542551-157542573 AGCCACTTGCGGCATCCAACAGG + Intronic
1041794587 8:61733452-61733474 AACCACTTGGGGAAACTGGATGG + Intergenic
1050033787 9:1413859-1413881 AGCCATTTGGGGAAAATAAGAGG + Intergenic
1051858018 9:21591893-21591915 AGCCTTTTGCAGAAACTACAGGG - Intergenic
1053649119 9:40145795-40145817 AGCAATTTGGGGAAACTATAAGG + Intergenic
1053756624 9:41318089-41318111 AGCAATTTGGGGAAACTATAAGG - Intergenic
1054535462 9:66230378-66230400 AGCAATTTGGGGAAACTATAAGG - Intergenic
1054904654 9:70403966-70403988 TCCCACTGGCGGAAACTCAAGGG + Intronic
1058245748 9:102623765-102623787 AGCCACTAGTGGATACAAAAAGG - Intergenic
1059216136 9:112564893-112564915 AGTCACTTGCACAAAGTAAATGG - Intronic
1060764183 9:126281585-126281607 TGCCATTTGGGGAAAATAAATGG - Intergenic
1202796881 9_KI270719v1_random:129068-129090 AGCAATTTGGGGAAACTATAAGG + Intergenic
1186458062 X:9726374-9726396 AGCTACTTGCTGAAACCATATGG - Intronic
1190450654 X:50577389-50577411 AGCCAATTGCTGAAAGTAAGAGG + Intergenic
1191069538 X:56385176-56385198 TGGCACTTGCAGAAACTTAAAGG - Intergenic
1192752336 X:74006231-74006253 AGCCAATTTAGGAAACTATATGG + Intergenic
1193533282 X:82682473-82682495 AGACACTGGGGGAAGCTAAAAGG + Intergenic
1193686972 X:84589146-84589168 ACCCATTTGCTGAAAATAAACGG + Intergenic
1196096083 X:111801464-111801486 AGCCACTTTGGGAAACAATAGGG - Intronic
1202074709 Y:21026436-21026458 AGCCACTTGAGGAAGGCAAAAGG + Intergenic