ID: 1141921802

View in Genome Browser
Species Human (GRCh38)
Location 16:87140469-87140491
Sequence CTCCGGAAGAGGAAAGTCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 82}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141921802_1141921813 18 Left 1141921802 16:87140469-87140491 CCACCGACTTTCCTCTTCCGGAG 0: 1
1: 0
2: 1
3: 6
4: 82
Right 1141921813 16:87140510-87140532 CATCGCTGTCCTTGGCTCGGGGG 0: 1
1: 0
2: 0
3: 7
4: 81
1141921802_1141921805 -10 Left 1141921802 16:87140469-87140491 CCACCGACTTTCCTCTTCCGGAG 0: 1
1: 0
2: 1
3: 6
4: 82
Right 1141921805 16:87140482-87140504 TCTTCCGGAGTGATACCGCACGG 0: 1
1: 0
2: 0
3: 2
4: 17
1141921802_1141921812 17 Left 1141921802 16:87140469-87140491 CCACCGACTTTCCTCTTCCGGAG 0: 1
1: 0
2: 1
3: 6
4: 82
Right 1141921812 16:87140509-87140531 CCATCGCTGTCCTTGGCTCGGGG 0: 1
1: 0
2: 0
3: 8
4: 137
1141921802_1141921810 16 Left 1141921802 16:87140469-87140491 CCACCGACTTTCCTCTTCCGGAG 0: 1
1: 0
2: 1
3: 6
4: 82
Right 1141921810 16:87140508-87140530 TCCATCGCTGTCCTTGGCTCGGG 0: 1
1: 0
2: 1
3: 16
4: 153
1141921802_1141921814 25 Left 1141921802 16:87140469-87140491 CCACCGACTTTCCTCTTCCGGAG 0: 1
1: 0
2: 1
3: 6
4: 82
Right 1141921814 16:87140517-87140539 GTCCTTGGCTCGGGGGACATTGG 0: 1
1: 0
2: 1
3: 7
4: 86
1141921802_1141921809 15 Left 1141921802 16:87140469-87140491 CCACCGACTTTCCTCTTCCGGAG 0: 1
1: 0
2: 1
3: 6
4: 82
Right 1141921809 16:87140507-87140529 TTCCATCGCTGTCCTTGGCTCGG 0: 1
1: 0
2: 0
3: 11
4: 183
1141921802_1141921808 10 Left 1141921802 16:87140469-87140491 CCACCGACTTTCCTCTTCCGGAG 0: 1
1: 0
2: 1
3: 6
4: 82
Right 1141921808 16:87140502-87140524 CGGCTTTCCATCGCTGTCCTTGG 0: 1
1: 0
2: 0
3: 4
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141921802 Original CRISPR CTCCGGAAGAGGAAAGTCGG TGG (reversed) Intronic
912000802 1:104832438-104832460 CTCAGGAAGAGGAGAGATGGTGG + Intergenic
922531718 1:226350078-226350100 CTCCGGCAGAGGAGAGAAGGAGG - Intergenic
1063889780 10:10617644-10617666 CTCCCCAGGAGGAAAGTCAGGGG - Intergenic
1065491776 10:26289626-26289648 CTCCGTAAGAGGAGAGTCAACGG - Intronic
1066547080 10:36511258-36511280 CTCTGGAAGTTGAAAGTCTGAGG - Intergenic
1067247815 10:44561017-44561039 CACAGGAAGAGCAAAGTCTGAGG - Intergenic
1071819808 10:89268135-89268157 CTTTGGAAGAGGAAAATAGGAGG + Intronic
1073039204 10:100588772-100588794 TTCTGGAAAAGGAAAGTCTGTGG + Intergenic
1074284302 10:112083513-112083535 CTGCAGAAGAGGAAAATGGGAGG - Intergenic
1074844694 10:117387185-117387207 CTCCTCAGGAGCAAAGTCGGGGG + Intergenic
1078407351 11:11082007-11082029 CCCAGGAAGAGGCAAGTTGGTGG - Intergenic
1089408864 11:118221595-118221617 CTCAGCAGGAGGTAAGTCGGGGG - Intronic
1091308003 11:134552185-134552207 CACTGGAAGAGGAAAGTTGGAGG + Intergenic
1096691654 12:53325428-53325450 CTGGGGCAGAGGAAAGGCGGGGG - Intergenic
1102644205 12:114393338-114393360 CTCTGGAAGGGCAAAGTGGGAGG - Intronic
1110857222 13:80310115-80310137 CTCAGGAAGAGGAAAGGGGCTGG - Intergenic
1111681880 13:91452225-91452247 CTTCGGAAGACCAAAGTAGGTGG - Intronic
1113632008 13:111894205-111894227 CTTAGGAAGAGGAAATCCGGAGG + Intergenic
1113862896 13:113501599-113501621 CTCAGCATGAGGAAAATCGGTGG + Intronic
1115196234 14:30803011-30803033 CTATGGAAGAGGAAGGTGGGAGG - Intergenic
1117201689 14:53396245-53396267 CTCAGGGAGAGGAAGGTCAGAGG - Intergenic
1119754039 14:77101314-77101336 CTCCGAAAGAGTAAAGTTTGGGG + Intronic
1127836514 15:62795077-62795099 CTCTGGAAGAGGAGAGCAGGGGG + Intronic
1129782768 15:78284897-78284919 CTCCTGAAGAGGAAGGTCCTTGG + Intronic
1132362067 15:101224748-101224770 GTCTGGGATAGGAAAGTCGGAGG - Intronic
1133772927 16:8878221-8878243 CTCAGGGAGAGAAAAGTAGGGGG - Intergenic
1134126971 16:11622552-11622574 CTCTGCAAGAGGAAAGAAGGGGG - Intronic
1135171488 16:20188064-20188086 TTCAGGAACAGGAAAGTCAGTGG + Intergenic
1139266034 16:65639328-65639350 ATTGGGAAGAGGAAAGTAGGGGG - Intergenic
1140658776 16:77167222-77167244 GGCAGGAAGAGGAAAGTCGAAGG - Intergenic
1141921802 16:87140469-87140491 CTCCGGAAGAGGAAAGTCGGTGG - Intronic
1144107182 17:11997074-11997096 CTCTGGAAGAGGAAACCCGATGG - Exonic
1149773822 17:59341868-59341890 CTGAGGGAGAGGAAAGGCGGTGG - Intronic
1150503228 17:65671267-65671289 CTCCCGAAGGGGAAATTGGGAGG + Intronic
1158136074 18:54209660-54209682 CTCCTGAAGAGTAAAGTCTCTGG - Intronic
1164873345 19:31665539-31665561 CTCCGGAAAAAGAAAGTTGTAGG + Intergenic
1167473838 19:49689259-49689281 CTCCGGAAGAGAAAAGGCCGAGG - Exonic
925372923 2:3360892-3360914 CTCAGGAAGAGGAAAGTATGGGG + Intronic
927658414 2:24971602-24971624 CTCCGGAAGAGTGACGTCGGAGG + Intronic
929248960 2:39732010-39732032 CTCGGGAAGAGGAATGTGGATGG - Intergenic
929600926 2:43204116-43204138 CTCAGGAAGAGGACAGGCAGTGG + Intergenic
931197565 2:60067041-60067063 ATCCAGAAGAGGTAAGTTGGTGG + Intergenic
932475877 2:72005461-72005483 TCCCAGAAGAGGAAAGTCAGGGG - Intergenic
938682161 2:133703023-133703045 CTCTGGAGGAGGAAGGTGGGAGG + Intergenic
940650550 2:156436312-156436334 GTCGGGAAGAGGGAAGGCGGGGG + Intronic
940847476 2:158657178-158657200 CTGAGTAAGAGGAAAGTAGGTGG - Intronic
946305331 2:218853807-218853829 TTCAGGAAGAGGAAAGTGGGCGG - Intergenic
1169284800 20:4298983-4299005 CTCTGGAAGTGGACAGTCGAAGG - Intergenic
1170970760 20:21114377-21114399 CTCCGGAAAAGGAAACTGGAAGG + Intergenic
1178546386 21:33496198-33496220 CTTCGAAAGAGGAAAGCAGGAGG - Intergenic
1178927917 21:36791553-36791575 CACCGTAAGAGAAAAGTCGCAGG - Intronic
1184436164 22:44478640-44478662 ATCTGGAAGAGGAAAGTCAGAGG - Intergenic
1184765291 22:46569128-46569150 CCCAGGGAGAGGAAAGTGGGCGG + Intergenic
951544929 3:23815223-23815245 CTCTGGAAGGGCAAAGTGGGTGG - Intronic
952225378 3:31370097-31370119 CTCTGTAAGAGGAATGTCAGTGG + Intergenic
952801737 3:37299096-37299118 CTCCGGGAGAGGAGAGTGGATGG + Intronic
954554393 3:51506612-51506634 CTCCTGAAGAGGCAATTCAGGGG + Intergenic
961073570 3:123961268-123961290 TTCCGGAAGCGGAAGCTCGGCGG - Exonic
961310001 3:125990556-125990578 TTCCGGAAGCGGAAGCTCGGGGG + Intergenic
964763124 3:160153221-160153243 CTCCAGAACAGGAAAGCCTGTGG - Intergenic
973606978 4:52597554-52597576 CTGGGGAAGAGGAAAGCCTGCGG + Exonic
978175034 4:105719433-105719455 CTCCAGAGGTGGAAGGTCGGAGG - Exonic
992206018 5:74430787-74430809 CTCTGGGAGAGGAAAGCCTGGGG - Intergenic
995182021 5:109238316-109238338 CGCCGGAAGAGGAACCTAGGAGG - Intergenic
1001113496 5:168918941-168918963 CTCCAGAAGTGGAATGTCTGGGG - Intronic
1001891646 5:175344368-175344390 CACTGGGAGAGGAAAGTGGGAGG - Intergenic
1002452887 5:179329788-179329810 CTTCAGAGGAGGAAAGTTGGGGG + Intronic
1002828621 6:797970-797992 GTCCTGAAGAGGCAAGTCGATGG + Intergenic
1006475313 6:34249102-34249124 ATCCGGTAGCGGAAAGCCGGTGG + Exonic
1007808821 6:44472134-44472156 ATCAGGAAGAGGAAAGGAGGTGG - Intergenic
1008730440 6:54475688-54475710 CTCAGAAAGGGGAAAGTGGGAGG + Intergenic
1008842992 6:55927224-55927246 CTCCCGAAGAGGGAAGTGAGAGG + Intergenic
1009983880 6:70759137-70759159 CTCTGGAAAAGGAAAGCCTGTGG + Intronic
1011521281 6:88209441-88209463 CTCCGGAAGAGGAAAGTGAGTGG + Intergenic
1013509489 6:110831536-110831558 CTTCGGAAGGTGAAAGTGGGAGG - Intronic
1015999749 6:139029972-139029994 CAAAGGAAGCGGAAAGTCGGAGG - Intronic
1022415670 7:30174773-30174795 CTCTGGGTGAGGACAGTCGGAGG + Intergenic
1031721919 7:125187392-125187414 TTCCGCAGGAGGAAAGTAGGGGG + Intergenic
1032285884 7:130538197-130538219 GTCTGGAAGATGAAAGTGGGAGG + Intronic
1036258264 8:7221824-7221846 CTCCGGAAGAGAAGAGGCTGCGG - Intergenic
1036467655 8:9016590-9016612 CTCCTTAAGAGGAAAGGCTGAGG - Intronic
1036468186 8:9022857-9022879 ATAAGGAAGAGGAAAGTGGGTGG - Intronic
1042672811 8:71283125-71283147 CTCTGGGAAAGGAAAGTGGGAGG - Intronic
1047543357 8:125792121-125792143 CTCAGGAAGAAGAAAAGCGGAGG + Intergenic
1058824657 9:108764222-108764244 CTGAGGAAGAGGAAAGTGAGGGG - Intergenic
1187362161 X:18638771-18638793 ATCCCGAAGAGCAAAGTTGGAGG + Intronic
1190732304 X:53234179-53234201 CTGGGGAACAGGAAAGTCTGGGG - Exonic
1197215279 X:123860686-123860708 TTCCGGAAGAGGAAATTAGCTGG + Intronic
1197280786 X:124533487-124533509 CTCTGGAAGAGGAAACAGGGAGG - Intronic
1200216002 X:154368550-154368572 CTGAGGAAGAGGAAGGTGGGTGG + Intronic