ID: 1141922726

View in Genome Browser
Species Human (GRCh38)
Location 16:87146785-87146807
Sequence TCCCCTTTGGACACCTATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 76}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141922726_1141922735 18 Left 1141922726 16:87146785-87146807 CCTGAATAGGTGTCCAAAGGGGA 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1141922735 16:87146826-87146848 GTGGAAGGGCCTGTCTCTTGAGG 0: 1
1: 0
2: 1
3: 18
4: 226
1141922726_1141922736 23 Left 1141922726 16:87146785-87146807 CCTGAATAGGTGTCCAAAGGGGA 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1141922736 16:87146831-87146853 AGGGCCTGTCTCTTGAGGCCTGG 0: 1
1: 0
2: 1
3: 47
4: 957
1141922726_1141922728 -10 Left 1141922726 16:87146785-87146807 CCTGAATAGGTGTCCAAAGGGGA 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1141922728 16:87146798-87146820 CCAAAGGGGAGCCTTCCCAGAGG No data
1141922726_1141922731 3 Left 1141922726 16:87146785-87146807 CCTGAATAGGTGTCCAAAGGGGA 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1141922731 16:87146811-87146833 TTCCCAGAGGCAGAAGTGGAAGG 0: 1
1: 0
2: 6
3: 46
4: 518
1141922726_1141922729 -1 Left 1141922726 16:87146785-87146807 CCTGAATAGGTGTCCAAAGGGGA 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1141922729 16:87146807-87146829 AGCCTTCCCAGAGGCAGAAGTGG 0: 1
1: 0
2: 3
3: 45
4: 441
1141922726_1141922732 4 Left 1141922726 16:87146785-87146807 CCTGAATAGGTGTCCAAAGGGGA 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1141922732 16:87146812-87146834 TCCCAGAGGCAGAAGTGGAAGGG 0: 1
1: 0
2: 4
3: 70
4: 673

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141922726 Original CRISPR TCCCCTTTGGACACCTATTC AGG (reversed) Intronic
900957871 1:5898700-5898722 TTTCCTTAGGACAACTATTCAGG + Intronic
905520909 1:38598967-38598989 TCCCCTTTGGCCTTCTATTCTGG + Intergenic
906006558 1:42477831-42477853 TCTCCTTTGGAAGCCTTTTCTGG - Intronic
912943997 1:114069554-114069576 TCCCCATTGCACAGTTATTCTGG + Intergenic
914877231 1:151521099-151521121 TACCCTGTGAATACCTATTCTGG + Intronic
915766424 1:158366950-158366972 GCCACTATTGACACCTATTCAGG - Intergenic
918225167 1:182474604-182474626 TCCCATCTGGTCACCTATACTGG + Intronic
920774757 1:208925114-208925136 CCCCCTTTTCACACCTCTTCTGG - Intergenic
921781399 1:219169689-219169711 TTCCATTTGGACACCTCTTATGG - Intergenic
1075332368 10:121583035-121583057 TCCCCTAAGGACACCCTTTCTGG + Intronic
1076076041 10:127534595-127534617 TCTCCTGTGGTCACCCATTCTGG - Intergenic
1079855772 11:25601872-25601894 TCCTCTTTAGACTGCTATTCTGG + Intergenic
1080897667 11:36459798-36459820 TCCCGTGTGTACACCTATGCTGG - Intronic
1082260144 11:50072132-50072154 TCCCCTTTGGCGGCCTCTTCAGG - Intergenic
1085714301 11:78858271-78858293 TCCCCTTTTGTCACCTCCTCTGG - Intronic
1087592929 11:100215212-100215234 GCCCATTGGGACATCTATTCTGG - Intronic
1089102289 11:115973724-115973746 TCCCCTGTGGACACAAATCCTGG - Intergenic
1089415155 11:118282748-118282770 TCCCGTTGTGACACCCATTCTGG + Intergenic
1095379474 12:41572914-41572936 TCCCCTTTGCATATCTATGCTGG - Exonic
1096263204 12:50105480-50105502 GCCCCTGTGGAACCCTATTCAGG - Intronic
1097692196 12:62744097-62744119 TCCCCTTTTGACAGACATTCAGG - Intronic
1104331526 12:127851308-127851330 CGCCCTTTGGACACATATTATGG - Intergenic
1109335451 13:60988430-60988452 TCTGCTTTGGAAAACTATTCAGG + Intergenic
1113749110 13:112766386-112766408 TCTCCTTTGGACACCTGTGCTGG + Intronic
1118463322 14:66007224-66007246 TCCCATTTGGACAAGTATTTTGG + Intergenic
1131320401 15:91384362-91384384 TCCCCAGTGGACACCAATCCAGG - Intergenic
1131484709 15:92810036-92810058 GCCACCTTGGACACCTTTTCAGG + Intergenic
1140164394 16:72534549-72534571 TCCCCTTTAGACATGAATTCTGG + Intergenic
1141922726 16:87146785-87146807 TCCCCTTTGGACACCTATTCAGG - Intronic
1142594362 17:1022371-1022393 TCCCCTTGGGACACCGAAGCCGG + Intronic
1147361890 17:39936042-39936064 TCCCCTGTGGTCACATATTGGGG + Intergenic
1157437555 18:47683673-47683695 TACCCCTTGGAAACCTATACTGG + Intergenic
932164602 2:69494521-69494543 TCTCCTTTTGACACCCCTTCAGG - Intronic
933645571 2:84810363-84810385 TCTCCTTTGGTCACTTTTTCTGG + Intronic
937336234 2:121064076-121064098 CCTCCTCTGGACACCTATCCTGG - Intergenic
939752157 2:146061748-146061770 ACCCCTCTGAACACCTTTTCTGG + Intergenic
1173752853 20:45490296-45490318 TCTCCTTTGGACCCCTGCTCAGG - Intergenic
1175787112 20:61718610-61718632 TCACCTTAGGACACCCAGTCGGG - Exonic
1177020584 21:15851767-15851789 TCTTCTTGGGACATCTATTCTGG + Intronic
1183738695 22:39658072-39658094 TCCCCTCTGGACACCCACCCTGG - Intronic
951465412 3:22995944-22995966 TTCCCTTGGGACACTTACTCTGG - Intergenic
953250585 3:41243149-41243171 TTCCCTTTTGACACCTATTTGGG - Intronic
957607497 3:82421400-82421422 TCCCATTTGGAGAACTGTTCTGG - Intergenic
959310108 3:104725367-104725389 TCCCCTTTGGACACCAAAGAAGG - Intergenic
964075696 3:152688863-152688885 TTGCCTTTGGATACGTATTCAGG - Intergenic
966659068 3:182394045-182394067 TCCCCGTTAAACACCTGTTCTGG + Intergenic
969401814 4:6960892-6960914 TACGCGTTGGACACCGATTCTGG - Intronic
972180773 4:36462568-36462590 TCACCATTGGCCAGCTATTCGGG + Intergenic
973649090 4:52979813-52979835 TCCCCTCTGCACACCTACCCAGG + Intronic
976382589 4:84417106-84417128 TGGCTTTTGGACACCTATTTTGG - Intergenic
977513869 4:97995610-97995632 TTCCCTTTGAACATCTACTCAGG - Intronic
977780685 4:100977453-100977475 TCCCCTGTCTACACCTCTTCAGG + Intergenic
979607935 4:122658523-122658545 TCCCATTTGGAAACCAATTATGG + Intergenic
989622240 5:43396176-43396198 TCCCCTTTTGAGACCAAATCGGG + Intronic
989966098 5:50467402-50467424 TTCCCTTTGGAAAGCTTTTCTGG + Intergenic
991217719 5:64174609-64174631 TCTTCTTTTGACATCTATTCAGG + Intronic
993925986 5:93866862-93866884 TATCTTTTGGAAACCTATTCTGG + Intronic
997125758 5:131225217-131225239 TCTCCTATGGACACCTCTCCAGG - Intergenic
1003833998 6:10047931-10047953 TGCCCTTTGGACACTTTTTTTGG + Intronic
1006610130 6:35289631-35289653 TCCCCTTTTGTCTCCTCTTCTGG - Intronic
1009380269 6:63019305-63019327 TCTCCTTTGGAAATCTATTTAGG - Intergenic
1013667001 6:112359340-112359362 TCCTCTAAGGACACCAATTCTGG + Intergenic
1015156312 6:130100437-130100459 TCCCATTTTCACACCTACTCTGG - Intronic
1017976071 6:159358513-159358535 TCCCCTTTGTACATCTTTTATGG - Intergenic
1019067984 6:169318500-169318522 TTCTCCTTGGACACCTATTGTGG - Intergenic
1025806340 7:64837503-64837525 GCCCCTTTGAACTCCTATACAGG - Intergenic
1026240866 7:68574191-68574213 ATCCCCTTGGACACCCATTCAGG - Intergenic
1027628014 7:80567548-80567570 TACCTTTTGCACAACTATTCTGG + Intronic
1027882258 7:83855723-83855745 TCCCCCTTGGGCAGCTTTTCTGG - Intergenic
1028468983 7:91184477-91184499 TCCCCTTTGGACAATTTTCCTGG - Intronic
1033756150 7:144399396-144399418 TCCCCTCTGGATACCTTTCCAGG - Exonic
1039145041 8:34437966-34437988 TCACCTTTGGATAAGTATTCAGG - Intergenic
1044611056 8:94092512-94092534 TCCCCTTGGGGTACCTATTTAGG - Intergenic
1047071345 8:121347398-121347420 TCCCCTATGGCCACCAAATCTGG + Intergenic
1047798036 8:128277897-128277919 TTACCTTTGGACAAGTATTCAGG - Intergenic
1190070134 X:47272753-47272775 ACCCATTTGGACATATATTCAGG + Intergenic
1193944690 X:87720940-87720962 TCTACTTTTGATACCTATTCAGG + Intergenic
1201770340 Y:17612354-17612376 GCCCCTTTGAACTCCTATACGGG + Intergenic
1201831214 Y:18293633-18293655 GCCCCTTTGAACTCCTATACGGG - Intergenic
1201941005 Y:19460012-19460034 CCCACTTTGGCCACCTACTCAGG - Intergenic