ID: 1141924611

View in Genome Browser
Species Human (GRCh38)
Location 16:87159940-87159962
Sequence AAGGAGAAGGAGAAGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4691
Summary {0: 1, 1: 28, 2: 148, 3: 704, 4: 3810}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141924604_1141924611 11 Left 1141924604 16:87159906-87159928 CCCTCCAGATTGATAAGTTGGCT 0: 1
1: 0
2: 9
3: 91
4: 340
Right 1141924611 16:87159940-87159962 AAGGAGAAGGAGAAGGAGACAGG 0: 1
1: 28
2: 148
3: 704
4: 3810
1141924605_1141924611 10 Left 1141924605 16:87159907-87159929 CCTCCAGATTGATAAGTTGGCTG No data
Right 1141924611 16:87159940-87159962 AAGGAGAAGGAGAAGGAGACAGG 0: 1
1: 28
2: 148
3: 704
4: 3810
1141924606_1141924611 7 Left 1141924606 16:87159910-87159932 CCAGATTGATAAGTTGGCTGTCA 0: 1
1: 0
2: 0
3: 8
4: 76
Right 1141924611 16:87159940-87159962 AAGGAGAAGGAGAAGGAGACAGG 0: 1
1: 28
2: 148
3: 704
4: 3810

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141924611 Original CRISPR AAGGAGAAGGAGAAGGAGAC AGG Intronic
Too many off-targets to display for this crispr