ID: 1141930651

View in Genome Browser
Species Human (GRCh38)
Location 16:87200259-87200281
Sequence CCATCCCCCAGTGCTGGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 273}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141930644_1141930651 -7 Left 1141930644 16:87200243-87200265 CCACTCTACATCCCCTCCATCCC No data
Right 1141930651 16:87200259-87200281 CCATCCCCCAGTGCTGGGTCTGG 0: 1
1: 0
2: 1
3: 26
4: 273
1141930642_1141930651 -2 Left 1141930642 16:87200238-87200260 CCCATCCACTCTACATCCCCTCC 0: 1
1: 0
2: 4
3: 31
4: 418
Right 1141930651 16:87200259-87200281 CCATCCCCCAGTGCTGGGTCTGG 0: 1
1: 0
2: 1
3: 26
4: 273
1141930641_1141930651 20 Left 1141930641 16:87200216-87200238 CCATCTGTGATTGAGGGGCAGTC 0: 1
1: 0
2: 1
3: 10
4: 117
Right 1141930651 16:87200259-87200281 CCATCCCCCAGTGCTGGGTCTGG 0: 1
1: 0
2: 1
3: 26
4: 273
1141930643_1141930651 -3 Left 1141930643 16:87200239-87200261 CCATCCACTCTACATCCCCTCCA 0: 1
1: 0
2: 5
3: 58
4: 645
Right 1141930651 16:87200259-87200281 CCATCCCCCAGTGCTGGGTCTGG 0: 1
1: 0
2: 1
3: 26
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141930651 Original CRISPR CCATCCCCCAGTGCTGGGTC TGG Intronic
900102998 1:970794-970816 CCCTCTCCAAGTCCTGGGTCAGG - Intronic
900189234 1:1346286-1346308 CCATCCCCCAGTCCCAGGCCTGG + Intronic
901054361 1:6441861-6441883 CCATCCCCCTGTGCTGGGGGGGG - Intronic
901106151 1:6758214-6758236 GCCTCCCCCAGTCCTGGCTCTGG + Intergenic
901188698 1:7390838-7390860 CCAGCCCCCAGTGCTTGGTGTGG - Intronic
901312228 1:8278239-8278261 CCAGTCTCCAGTTCTGGGTCTGG - Intergenic
901325120 1:8360959-8360981 CCAGCCCCCACTGCACGGTCAGG - Exonic
901789461 1:11646767-11646789 CCATAGCCCAGTGCAGGCTCCGG + Intergenic
901936448 1:12630331-12630353 CCATCCCTCTGTGTTGGGGCAGG + Intergenic
902678853 1:18029105-18029127 CCAGGCCCCAGTGCTGGGGCAGG + Intergenic
902897086 1:19486022-19486044 CGCTCCCCCAGTGCTGGGTTGGG - Intergenic
903365153 1:22801605-22801627 CCATCCCCTCGTGTGGGGTCTGG - Intronic
904339911 1:29828056-29828078 CCCTCTCCCAGAGCTGGTTCCGG - Intergenic
904969277 1:34406340-34406362 ACAACCCCCAGTGCAAGGTCAGG + Intergenic
907457573 1:54585343-54585365 CCTGCCCCCAGGCCTGGGTCAGG - Intronic
912518573 1:110230582-110230604 CCCTCCCACAGGGCTGGGTCTGG + Intronic
914195736 1:145447058-145447080 CCGACCTCCAGTGCCGGGTCGGG - Intergenic
915312160 1:155010263-155010285 AAATCCCCCAGTCCTGGTTCTGG - Exonic
915529463 1:156494920-156494942 CCATTCCCCAGGTCTGGGCCTGG + Intronic
915561491 1:156690760-156690782 CCGTCCCACAGTGCTTGCTCTGG + Intergenic
915582601 1:156823973-156823995 CCATCTGCCAGTGCTGGGCCTGG + Intronic
919792296 1:201300064-201300086 CTATCTCCCAGGGCTGGGTGGGG - Intronic
920674603 1:208030396-208030418 CCCTCTCCCAGCGCTGGGCCGGG + Intronic
921120157 1:212129289-212129311 GCCTCCCCAAGTGCTGGGGCTGG - Intergenic
923144037 1:231185446-231185468 CCAGCCCCCAGTGCAGGACCAGG + Intronic
1063591517 10:7400088-7400110 CCATTTCCCAGTGCAGGCTCTGG - Intronic
1068709934 10:60122820-60122842 TAATGCCCCAGTGCTGGGACTGG - Intronic
1069910733 10:71757662-71757684 CCATCCCACCCTGCTGTGTCAGG - Intronic
1070149918 10:73799317-73799339 CCATGCCCCAGTCCTGGACCCGG - Exonic
1070540709 10:77413328-77413350 CCAGCCCCGAATGCTGGGGCTGG + Intronic
1074556856 10:114499448-114499470 CCATCCACCAGAGCTGTGTTTGG - Intronic
1075445194 10:122508180-122508202 CCATCCCCAAGTGCTGCGCGGGG - Intronic
1076058236 10:127392744-127392766 CCCACCCCCAGCGCCGGGTCGGG + Intronic
1077251376 11:1562162-1562184 CCACCCACCAGTGCTGGGTGAGG + Intronic
1077299410 11:1840222-1840244 CCATGTCCCAGTGCAAGGTCTGG + Intronic
1077389021 11:2290773-2290795 CCACCACCCAGAGCTGGCTCAGG + Intergenic
1078110276 11:8386586-8386608 CCATCCCCCGCTGCTGGCTTAGG + Intergenic
1079109904 11:17599557-17599579 TCTTCCCCAAGTGCTGGGCCTGG - Intronic
1081063031 11:38503995-38504017 CCATCCCCCACTGCTGATTGTGG + Intergenic
1082991477 11:59210969-59210991 CCAGCCTCCACTGGTGGGTCTGG + Exonic
1083000606 11:59287593-59287615 CCAGCCTCCACTGGTGGGTCTGG + Intergenic
1083281515 11:61629755-61629777 CCACCCCCCACTGCTTGGTGGGG - Intergenic
1084020314 11:66413415-66413437 CCATCCCCCAGGCCTGCCTCTGG - Intergenic
1084044542 11:66561184-66561206 CCAGCCCCCAGAGCTGGCTCTGG + Intronic
1084122580 11:67078052-67078074 GCCTCTCCCAGTGCCGGGTCTGG - Intergenic
1084490542 11:69476091-69476113 CGATCCCCATGTTCTGGGTCAGG - Intergenic
1087141485 11:94769042-94769064 CCACCCGCCAGAGCCGGGTCTGG - Intronic
1088420992 11:109646738-109646760 CATTCCCCGAGTGCTGGGACTGG - Intergenic
1089241522 11:117085415-117085437 CCAAACCCCAGGGCTGGGTATGG - Intronic
1089905653 11:122035523-122035545 ACATCCCCCAGTGCGGGCTTAGG + Intergenic
1089918815 11:122187283-122187305 CCATCCCCTAATCCAGGGTCTGG - Intergenic
1091283813 11:134397162-134397184 CCATCCCCTAATCCTGGGCCAGG + Intronic
1091656163 12:2348267-2348289 CCCTCCCCCACTGCAGGGCCAGG + Intronic
1092760136 12:11802405-11802427 CCATCTCAAAGTTCTGGGTCTGG + Intronic
1092773761 12:11922874-11922896 CCACCCCCCATCCCTGGGTCAGG - Intergenic
1096747034 12:53735791-53735813 CCCTCCCCCAGTGCTGTTCCTGG + Intergenic
1099338287 12:81393748-81393770 CCAACACCCAGTGGTGGTTCTGG + Intronic
1099960457 12:89392151-89392173 CCCTCCCCCACTCCAGGGTCAGG + Intergenic
1100758921 12:97784338-97784360 TCAACCCCCAGTCCTGAGTCAGG - Intergenic
1101880386 12:108622193-108622215 CCATCCCTCAGTGCAGGATGGGG - Intergenic
1102856606 12:116299716-116299738 CCAACCCACAGTGCTGGGAATGG + Intergenic
1102920141 12:116785635-116785657 CCAGTGCCCAGTGCTGGGCCGGG - Intronic
1104763902 12:131314232-131314254 CCATCCCCAAGTGGTGGGTGGGG - Intergenic
1104815595 12:131643824-131643846 CCATCCCCAGGTGGTGGGTGGGG + Intergenic
1104946659 12:132417661-132417683 GCTTCCCACAGAGCTGGGTCCGG - Intergenic
1105008024 12:132735203-132735225 ACATCCCCCAGGTCTGGGACGGG + Intronic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1108420447 13:50243960-50243982 TCATCCCCCAGTGTGTGGTCAGG + Intronic
1111917933 13:94381302-94381324 CTATCCCACAGTTCTGGGGCTGG + Intronic
1113596480 13:111537566-111537588 CCATCCCCCCATGCTGGGCATGG - Intergenic
1114470715 14:22959021-22959043 GCCTCCCAAAGTGCTGGGTCAGG - Intronic
1114577307 14:23726457-23726479 CCATCCCCCAGTGTTGCCTCGGG - Intergenic
1117132498 14:52699822-52699844 GCTTCCCAAAGTGCTGGGTCAGG - Intergenic
1117486816 14:56205801-56205823 CCAGCACCCAGTGCAGGGTCAGG - Intronic
1118000899 14:61522620-61522642 TCTTCCCCCAGTGCTAGGTCAGG + Intronic
1120805549 14:88745315-88745337 CCATGCCTCTGTGCTGGTTCAGG + Intronic
1121946400 14:98126842-98126864 CGATCCCCCAGTTCTAGGGCTGG + Intergenic
1122278919 14:100609974-100609996 CCCTCCCCCAGCCCTGGGGCAGG - Intergenic
1122544490 14:102514666-102514688 CCACCCACCAGTGGTGGGACTGG + Intergenic
1122906347 14:104803347-104803369 GCATCCCCCAGGGTGGGGTCTGG + Exonic
1122982297 14:105197187-105197209 CCAGACCCCAGGGCGGGGTCAGG - Intergenic
1123003905 14:105312243-105312265 CCAACCCCCAGTCATGGGACAGG - Exonic
1123135290 14:106022201-106022223 CCCTCCACCTGTGCTGTGTCTGG - Intergenic
1123397917 15:19955531-19955553 CCCTCCACCTGTGCTGTGTCTGG - Intergenic
1123585831 15:21760061-21760083 CCCTCCACCTGTGCTGTGTCTGG - Intergenic
1123622473 15:22202649-22202671 CCCTCCACCTGTGCTGTGTCTGG - Intergenic
1124168454 15:27350642-27350664 CCATCCTCCAGCGCTGGCCCTGG - Intronic
1124342853 15:28901296-28901318 CCAAACCCCAGAGCTGGGTGGGG - Intronic
1124410589 15:29433150-29433172 ACAGCCACCAGTGCTGGGGCTGG - Intronic
1125714956 15:41814365-41814387 CCAGCAGCTAGTGCTGGGTCAGG + Intronic
1126379536 15:48031643-48031665 CCTTCCCCCATCGCTGGCTCAGG + Intergenic
1128640598 15:69333519-69333541 TCATCTCCCAGTGCGGGGTGGGG - Intronic
1128686519 15:69690326-69690348 CCTTGCCCCAGTCCTGTGTCTGG + Intergenic
1128689140 15:69710021-69710043 ACATTCCCCAGAGCTGGGGCTGG - Intergenic
1129164356 15:73767923-73767945 CCATCCCTGAGGGCTGGGCCAGG + Intergenic
1129239791 15:74244537-74244559 CCCTACCCCAGGGCTGGGTATGG - Intronic
1129262678 15:74377423-74377445 TCTGCCCCCAGTGCTGGCTCTGG - Intergenic
1129263515 15:74382091-74382113 CCCTCACTCAGTGCTGGGCCTGG - Intergenic
1129384469 15:75188337-75188359 CCAGCTCCCAGTGCTGTGGCTGG - Intergenic
1130257442 15:82332343-82332365 TCATCCCCCATTGCAAGGTCAGG + Intergenic
1130691607 15:86086196-86086218 CCATCTCCCAGGGCTGGAACTGG - Intergenic
1132601102 16:773359-773381 CCAACCACCACTGCTGGCTCTGG + Intronic
1132801377 16:1756053-1756075 CCACCCGCCAGTGCTCGGTGGGG - Intronic
1132903128 16:2268950-2268972 CCATCGGCCGGTGCAGGGTCCGG + Intergenic
1132977808 16:2719371-2719393 TCACCTCCCAGGGCTGGGTCAGG - Intronic
1132977855 16:2719532-2719554 CCCTCTCCCAGTCCTGGGTCAGG - Intronic
1133009156 16:2900742-2900764 CCACCCCTCACTGCTGGGTAAGG - Intergenic
1133311521 16:4849850-4849872 GCCTCCCAAAGTGCTGGGTCCGG + Intronic
1134305344 16:13027039-13027061 CCCTCCCCCACTGCTGTATCTGG + Intronic
1136846528 16:33580749-33580771 CCATGCCCCAATGCTGGGGCTGG + Intergenic
1139447537 16:67007079-67007101 CCAGCTCCCAGTACTGGGGCTGG - Intronic
1139778054 16:69329637-69329659 CTAGCCCCCTGGGCTGGGTCAGG + Intronic
1140480979 16:75262763-75262785 CCATCTACCACTGCTGGGGCTGG + Intronic
1141044396 16:80703567-80703589 CCATCACCCTGTGGTGGCTCAGG + Intronic
1141930651 16:87200259-87200281 CCATCCCCCAGTGCTGGGTCTGG + Intronic
1142412341 16:89923145-89923167 GGATCCCCCAGCGCTGGGCCGGG - Intronic
1203108236 16_KI270728v1_random:1429403-1429425 CCATGCCCCAATGCTGGGGCTGG + Intergenic
1143269652 17:5666180-5666202 CCATCCCCCAGTCCATGTTCTGG + Intergenic
1144593282 17:16543053-16543075 TCATCTCCCAGTGCAGGGTGAGG - Intergenic
1145965083 17:28911293-28911315 CAATCCCCCACTGCTGAGACAGG + Intronic
1147892028 17:43724153-43724175 CCATTTTTCAGTGCTGGGTCAGG + Intergenic
1148355236 17:46971443-46971465 CTCTCCTCCAGTGCTGGGTTAGG + Intronic
1148557867 17:48589369-48589391 CCTTCCCCCACTCCTGGTTCAGG + Intronic
1149388560 17:56166993-56167015 CCAGCCCCTAGTGCTGTGCCTGG + Intronic
1151579557 17:74970580-74970602 CCATGGTCCAGTCCTGGGTCAGG - Intronic
1156498313 18:37540578-37540600 CCCTGCCCCACTGCTGCGTCTGG - Intronic
1157280752 18:46344991-46345013 CCCTCCCTAAGGGCTGGGTCAGG + Intronic
1157619271 18:49006746-49006768 CATTCCCCCAGTGCTGGGCAGGG + Intergenic
1158446723 18:57528565-57528587 CTATCACCCAGGGCTGGATCAGG + Intergenic
1158525277 18:58207647-58207669 CCATCCCCCAGTGATGTTTGGGG + Intronic
1160686942 19:441300-441322 CCAGCGCCCAGTTCAGGGTCTGG + Intronic
1161323698 19:3652939-3652961 CGACCCCCAAGGGCTGGGTCTGG + Intronic
1161420833 19:4175202-4175224 CCGGCCCCCAGGGCTGGCTCGGG - Intronic
1161994023 19:7701555-7701577 CCATCACGCAGTGGTGGGACTGG + Intronic
1162460493 19:10811419-10811441 GCATCCCCCAGTGCAGGGCATGG - Intronic
1163427420 19:17246850-17246872 CCATCCCCCAGTACCGGGGCTGG + Intronic
1164412336 19:28016349-28016371 TAATCCCCCAGTGCTGAGTATGG - Intergenic
1164576316 19:29407326-29407348 CCAGCACCCAGGGCTGGGCCAGG + Intergenic
1165034023 19:33020004-33020026 CCATGCCCCGATGCTGGGGCTGG - Intronic
1165935628 19:39386864-39386886 CCGCCCCCCAGTGAGGGGTCTGG + Intronic
1166283369 19:41809532-41809554 CCAGCCCTGAGTGCAGGGTCTGG + Intronic
1166563282 19:43747660-43747682 CCATGCCCCGGTTCTGGATCTGG + Exonic
1166688768 19:44810700-44810722 CCACCCCCCAGGGCAGGGCCAGG - Intronic
1166994663 19:46714416-46714438 CCCCACCCCAGTGCTGGGCCTGG - Intronic
1167035952 19:46995076-46995098 GCCTCCCCCAGTCCTGAGTCAGG + Intronic
1167422643 19:49413225-49413247 CCCTCCCCCAAGGCAGGGTCAGG - Intronic
1168315573 19:55483429-55483451 CCCTCCTCCAGTGCTGGGGCTGG + Exonic
1168607200 19:57769687-57769709 CCATCCGGCGATGCTGGGTCTGG + Exonic
927879784 2:26682242-26682264 CCCTCCCCCAGGGCAGTGTCAGG + Intergenic
929247302 2:39716804-39716826 CCATTCCCTAGTGTAGGGTCTGG + Intronic
929760455 2:44802095-44802117 CTATCCCCCAGGACTGGGCCCGG - Intergenic
932028030 2:68155570-68155592 CCCTCCCAAAGTGCTGGATCAGG - Intronic
932667448 2:73708540-73708562 CCAGACCCCATTGCTGGGTTAGG + Intergenic
932833533 2:75012886-75012908 CCATCCCTGAGAGGTGGGTCAGG - Intergenic
934119693 2:88827559-88827581 ACTTCCCCCAGTCCTGGGACTGG + Intergenic
934540961 2:95174649-95174671 CCATCCCTCCCTGCTGGGTTAGG + Intronic
934986975 2:98894517-98894539 CCACTCACCAGTGCTGGGCCAGG - Intronic
936163157 2:110100098-110100120 ACTTCCCCCAGTCCTGGGACTGG + Intronic
936568646 2:113598238-113598260 TCAGTGCCCAGTGCTGGGTCAGG + Intergenic
937105334 2:119307106-119307128 CCCTCCCTCAGTGCCGTGTCTGG - Intronic
941264176 2:163338858-163338880 CCATCACCCAGGGGTGAGTCTGG - Intergenic
941524705 2:166592549-166592571 CCAACCCCCAGTAGTGGGTTCGG + Intergenic
941933528 2:170965540-170965562 GTTTCCCCCAGTGCTGGGCCAGG + Intronic
941951284 2:171160169-171160191 CCATCCCCCACCCCAGGGTCTGG + Intronic
942596416 2:177595369-177595391 GCTTCCCCAAGTGCTGTGTCTGG + Intergenic
946015220 2:216598893-216598915 CCATCCCCCATGGCTGAGACAGG + Intergenic
946726801 2:222669783-222669805 TCTTCCCCCAGTGCTAGGTGGGG - Intergenic
947183913 2:227437951-227437973 TCCTCCCAAAGTGCTGGGTCAGG - Intergenic
1168869881 20:1118996-1119018 GCTTCTCCCAGTGCAGGGTCTGG + Intronic
1170909381 20:20549508-20549530 CCCTCCCCCAGTGCTGTCTTTGG - Intronic
1171011651 20:21512474-21512496 CCTCCCCCCAGTGCACGGTCTGG - Exonic
1171214589 20:23342908-23342930 CCAGCCCCCAGTCCTGAATCAGG + Intergenic
1171981532 20:31632564-31632586 CCAGCCCTCAGTGTTGGTTCTGG + Intergenic
1172244835 20:33438736-33438758 CCAGCCCCCAGTGCTGGGATGGG + Intronic
1172762437 20:37332074-37332096 CCCAGCCCCAGTGCTGGCTCAGG - Intergenic
1173256621 20:41398359-41398381 CCATCCCGCAGTGCTGGTGTTGG - Intergenic
1173401687 20:42731560-42731582 CCTTCACACAGTGCTGGGCCTGG - Intronic
1174083027 20:47984172-47984194 AAAGCCCCCAGTGCTGGCTCTGG + Intergenic
1174364764 20:50049921-50049943 CCCTCCCCCAGGTCTGGGCCTGG + Intergenic
1174396524 20:50250345-50250367 GCATCGCCCAGCCCTGGGTCTGG + Intergenic
1174636255 20:52002314-52002336 TCAGCCCCCAGTGGTGGATCAGG - Intergenic
1175261673 20:57678479-57678501 CCCTCCCCCAGTGCCAGGCCTGG - Intronic
1177184979 21:17783343-17783365 CCAGCCCCCAGAGCTGGTTTAGG + Intergenic
1178799228 21:35777024-35777046 AAATCCCCCAGTGCTGTCTCAGG + Intronic
1179189833 21:39114400-39114422 CAATCCCCCAGTGCAGTGCCTGG - Intergenic
1179831515 21:44000070-44000092 CGCACCCCCATTGCTGGGTCAGG + Intergenic
1180781512 22:18522723-18522745 CTATCTGCCAGTGCTGGGCCTGG - Intergenic
1180798438 22:18619513-18619535 CCATCCCCCAGCACTGGATGGGG + Intergenic
1181033891 22:20160868-20160890 CCCTCACCCAGTGCAGGGCCAGG + Intergenic
1181223280 22:21375752-21375774 CCATCCCCCAGCACTGGATGGGG - Intergenic
1181238396 22:21462066-21462088 CTATCTGCCAGTGCTGGGCCTGG - Intergenic
1181777821 22:25172228-25172250 CCATTCCCCAGTTCTGACTCAGG + Intronic
1182472713 22:30558456-30558478 CCCTCCCCCAGGCCTGGGCCAGG + Intronic
1183623633 22:38989021-38989043 CCCTGCCCCAATGCTGGGTGTGG + Intronic
1183694520 22:39414146-39414168 CCATCAGCCAGTCCTGGGTAGGG + Intronic
1184142602 22:42586871-42586893 ACATCCCTCAGTCCTGGGCCAGG + Intronic
1184294445 22:43514995-43515017 TCTTCCCCCGGTGATGGGTCCGG + Intergenic
1184938124 22:47739918-47739940 GCATCCCCCGGAGCTGGGTGGGG - Intergenic
1185075679 22:48680834-48680856 CCACCGTCCAGTGCTGGGCCGGG + Intronic
1185078042 22:48693798-48693820 CCACACCCCACAGCTGGGTCAGG - Intronic
1185186153 22:49401699-49401721 CCAAGCCCCAGTGGTGTGTCTGG + Intergenic
1185347062 22:50315104-50315126 CAATCCACCTGTGCTGGGCCTGG + Intronic
953613044 3:44463732-44463754 TCATCTCCCAGTTCTGGGTGGGG - Intronic
954035284 3:47847976-47847998 CCCTCCCCCAGTGGTTGGCCGGG - Intronic
954778739 3:53044781-53044803 CCATCAACCAGTGCTGCTTCGGG + Intronic
954906555 3:54067961-54067983 CCATGGCCCTGAGCTGGGTCGGG + Intergenic
954928921 3:54262805-54262827 CCACCTCCCAGTGCTGGGAGTGG + Intronic
959025382 3:101234689-101234711 CTATCCCTCACTGCTGGGTAAGG - Intronic
960498488 3:118406228-118406250 CCATCTTCCACTGCTGTGTCTGG + Intergenic
961129729 3:124454931-124454953 TCATCCCTCAGTGCTGGGGTGGG - Intronic
961554675 3:127689829-127689851 CCATGTCCCCCTGCTGGGTCAGG - Exonic
961594439 3:128005920-128005942 CCATCCCCTGTTGCTGGGTCAGG + Intergenic
961676910 3:128573263-128573285 CCATGACCCAGTCCTGGGTAAGG - Exonic
961756457 3:129130028-129130050 CCATCCCCCAGTGGTACCTCAGG - Exonic
961866725 3:129958789-129958811 CCACCCCACAGTGCTCTGTCTGG - Intergenic
962240691 3:133748401-133748423 CTCTCCCCCAGGGCTGTGTCTGG + Exonic
962259036 3:133891473-133891495 CCAGCCCCCAGAGGCGGGTCAGG + Intronic
964272761 3:154976195-154976217 CCATCACCCAGTTCTGTTTCAGG - Intergenic
966133340 3:176669748-176669770 CTATCCCCCAGAGCTGTATCTGG + Intergenic
968603986 4:1522883-1522905 CCATCACCCAGTGCTAGGGATGG - Intergenic
968604893 4:1530493-1530515 TCATCCCCTGGTGCTGGGGCTGG + Intergenic
968614615 4:1571733-1571755 CCTTCCCCCTGTGCAGGGTCAGG - Intergenic
968660653 4:1797475-1797497 CCGTCCCCCCGTGCTGGACCAGG + Intronic
968663200 4:1807231-1807253 CGAGCCCCCACTGCTGGGTGGGG - Exonic
969091471 4:4696928-4696950 CCATCCTCTACTCCTGGGTCAGG + Intergenic
969531317 4:7732662-7732684 CCATCCCCCAGTGGTGGTCAGGG - Intronic
969564197 4:7968030-7968052 GCATCCCTCAGAGCTGGCTCAGG + Intronic
969612869 4:8236850-8236872 GCATCCCCCGGTGCTGTGCCAGG + Intronic
983163185 4:164442857-164442879 CAGCTCCCCAGTGCTGGGTCTGG - Intergenic
985560985 5:585682-585704 CCACCCCCCAGTGCTGCGTTTGG - Intergenic
985659794 5:1151409-1151431 CCCTCCCCTAGTGCTGGGGCTGG - Intergenic
986283804 5:6345439-6345461 CCAGGCCCCAGTGCTAGGTCAGG - Intergenic
989147670 5:38264733-38264755 CCATATCCCAGTGCTGATTCAGG + Intronic
991985892 5:72286813-72286835 CCATCACCCAGTGCTTGTTGAGG - Intronic
991986374 5:72290949-72290971 CCATCACCCAGTCCTTGGTGAGG - Intronic
993971846 5:94429653-94429675 CCACCCCCCAGGGCTGAGTAGGG - Intronic
997568455 5:134906976-134906998 CCATTTCCCAGTCCTGGGTGTGG + Intronic
997588910 5:135061135-135061157 CCCTGCCCCAGGGCTGGGACAGG - Intronic
998151536 5:139760166-139760188 CCCTACCCCAGTCCTGGGCCTGG + Intergenic
998403923 5:141863086-141863108 CCACCTCCCACTGCTGGCTCAGG + Intronic
999202266 5:149824797-149824819 CCATCCCCAGGGCCTGGGTCAGG + Intronic
999228523 5:150047497-150047519 CCCTCCCCCAGTGCTGGCAGAGG - Intronic
1000012134 5:157242950-157242972 TCTTTCCCCAGTGCTTGGTCTGG - Intronic
1000991592 5:167916983-167917005 CCATCACCCAGGGCTAGGGCAGG + Intronic
1002188510 5:177467133-177467155 CCCGCCCCCAGCGCTGGGTTAGG - Intronic
1002380973 5:178829754-178829776 CCAGCCCCCCGTGGAGGGTCAGG - Intergenic
1002506206 5:179680872-179680894 CCATCCCCAAGATCTGGTTCAGG + Exonic
1003946962 6:11084721-11084743 CCATGCCCCTGTGGTGGTTCTGG + Intergenic
1004566617 6:16803879-16803901 CCACCCTCCAGTGCAAGGTCTGG - Intergenic
1006069819 6:31490352-31490374 CTCTCCCTCAGTGCTGGCTCTGG - Intergenic
1006079735 6:31558367-31558389 CCCTCCCCCAGGGCAGGGCCAGG - Exonic
1006808879 6:36806973-36806995 CCATCCCCCAGTCCTCACTCTGG - Intronic
1008165007 6:48126116-48126138 TCATTTCCCAGTGCTGCGTCTGG + Intergenic
1011736432 6:90314887-90314909 CCTTGCCGCAGTGCTGGGTTGGG - Intergenic
1011791926 6:90907769-90907791 GCAACTCCTAGTGCTGGGTCAGG - Intergenic
1013416638 6:109931480-109931502 CCATCTCCCAGTTATGGGTTAGG + Intergenic
1015213447 6:130722629-130722651 TCATCCCCCAGTTCTGGCTCTGG - Intergenic
1017038735 6:150290378-150290400 ACATCCCCCAGTGCAGGCACAGG - Intergenic
1017604688 6:156121520-156121542 GTAGCCCCCAGTGCTAGGTCAGG - Intergenic
1018365125 6:163112291-163112313 CCATCCCCCAGTCCTATGGCAGG + Intronic
1018596027 6:165481415-165481437 CCAACCCCCAGCGCTGGCCCAGG + Intronic
1019217620 6:170453872-170453894 TCAGCCCCCAGTGCTGCGTGGGG + Intergenic
1019325982 7:438514-438536 CCATGGCCCAGAGCTAGGTCCGG - Intergenic
1022559370 7:31333483-31333505 CCACTCCCAGGTGCTGGGTCAGG - Intergenic
1023793581 7:43772485-43772507 CCCTGCCCCAGGGCTGGGTGTGG + Intronic
1026819866 7:73539894-73539916 CCAGCCCCCAACGCTGGGCCAGG - Exonic
1026847316 7:73705376-73705398 CCCTCCCCCAATTCTGGGCCAGG + Intronic
1027515680 7:79138748-79138770 GCCTCCCACAGTGCTGGGTTAGG - Intronic
1029327733 7:99824151-99824173 GCATTCCCCAGTGCTGGCTGGGG + Intergenic
1029481903 7:100818491-100818513 CCATCCCCCAGCCCTGGGGTGGG - Intronic
1030863088 7:114661710-114661732 CCATCCCTGAGTGCTTGATCAGG + Intronic
1033242344 7:139690548-139690570 CCACCCCAAAGTGCTGGGGCTGG - Intronic
1034825134 7:154255451-154255473 CTTTCCCCCAGTGCTGGGAGTGG - Intronic
1034951662 7:155301095-155301117 CCACCACCCAGTACTGGGGCTGG - Intronic
1035209014 7:157314118-157314140 CCCGCTCCCAGGGCTGGGTCGGG - Intergenic
1036565016 8:9931098-9931120 CCATCCCACATTTCTGGGTTAGG - Intergenic
1040324617 8:46335451-46335473 GAATCCCCCAGTGCTGCCTCAGG + Intergenic
1046284152 8:112073717-112073739 CAATGCCCCAGTGGTGGGACAGG + Intergenic
1048195394 8:132328011-132328033 CCATGCCCCCATGCTGGCTCTGG - Intronic
1048992396 8:139768405-139768427 CCACCCACCAGTGGTGGGCCAGG + Intronic
1048992575 8:139770007-139770029 CCACCCGCCAGTGGTGGGCCAGG + Intronic
1049088093 8:140493499-140493521 CAGTCCCCCAGTGCTGGGGTGGG + Intergenic
1049181627 8:141225953-141225975 CCAGCCCCCAGCCCTAGGTCAGG + Intronic
1049427794 8:142545047-142545069 CCAGCAGCCAGGGCTGGGTCAGG - Intergenic
1057665729 9:97043963-97043985 GCAACCACCAGTGCTGGGACAGG - Intergenic
1058635712 9:107036522-107036544 CACTTCCCCAGTGCTGGGTTGGG + Intergenic
1058799211 9:108528871-108528893 CCATCATGCAGTGCTGGGTTTGG + Intergenic
1060448439 9:123714225-123714247 GCATTCCCCACTGCTGGGGCTGG - Intronic
1061013176 9:127967331-127967353 CCATCTCCTAGGGCTGGGTGTGG - Intronic
1061258156 9:129464849-129464871 CCATCCCACCTTGCTGGCTCCGG - Intergenic
1062568199 9:137172570-137172592 CCTTCCTCCAGGGCTGGGGCAGG + Intergenic
1062698931 9:137889292-137889314 CCGACCTCCAGTGCCGGGTCGGG + Intronic
1185543108 X:920049-920071 CCATCCCTAGGTGCTGGCTCAGG - Intergenic
1189379289 X:40490447-40490469 CAATCCCCCAGAGCAAGGTCTGG - Intergenic
1190398540 X:50009107-50009129 CCACCACCCAGTGCAGGATCTGG - Intronic
1190872447 X:54435590-54435612 ACAGCCCCCAGGGCTGGGTCAGG + Intergenic
1191065523 X:56343321-56343343 CCATCCCCCATTGCTGGGTGTGG - Intergenic
1192809575 X:74536722-74536744 CCCACCCCCAGCGCTCGGTCCGG + Intergenic
1196232579 X:113240865-113240887 CCATACCACACTGCTGGGGCTGG + Intergenic
1196717690 X:118826199-118826221 CCTTCCACCAGTGGTGGTTCTGG + Exonic
1200092832 X:153643887-153643909 CCAGCCCCCAGTGCAGGGCCTGG - Intronic