ID: 1141932538

View in Genome Browser
Species Human (GRCh38)
Location 16:87215748-87215770
Sequence CTCTCCTAACACCTGCAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 259}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141932538_1141932544 17 Left 1141932538 16:87215748-87215770 CCTTTCTGCAGGTGTTAGGAGAG 0: 1
1: 0
2: 1
3: 28
4: 259
Right 1141932544 16:87215788-87215810 AGGGCCTGACTTCTGGTTTGCGG No data
1141932538_1141932540 -2 Left 1141932538 16:87215748-87215770 CCTTTCTGCAGGTGTTAGGAGAG 0: 1
1: 0
2: 1
3: 28
4: 259
Right 1141932540 16:87215769-87215791 AGAGCTCAACCTCCGTCTTAGGG 0: 1
1: 0
2: 1
3: 6
4: 54
1141932538_1141932547 22 Left 1141932538 16:87215748-87215770 CCTTTCTGCAGGTGTTAGGAGAG 0: 1
1: 0
2: 1
3: 28
4: 259
Right 1141932547 16:87215793-87215815 CTGACTTCTGGTTTGCGGCTGGG 0: 1
1: 0
2: 0
3: 11
4: 119
1141932538_1141932543 10 Left 1141932538 16:87215748-87215770 CCTTTCTGCAGGTGTTAGGAGAG 0: 1
1: 0
2: 1
3: 28
4: 259
Right 1141932543 16:87215781-87215803 CCGTCTTAGGGCCTGACTTCTGG 0: 1
1: 0
2: 0
3: 5
4: 63
1141932538_1141932546 21 Left 1141932538 16:87215748-87215770 CCTTTCTGCAGGTGTTAGGAGAG 0: 1
1: 0
2: 1
3: 28
4: 259
Right 1141932546 16:87215792-87215814 CCTGACTTCTGGTTTGCGGCTGG 0: 1
1: 0
2: 0
3: 11
4: 106
1141932538_1141932539 -3 Left 1141932538 16:87215748-87215770 CCTTTCTGCAGGTGTTAGGAGAG 0: 1
1: 0
2: 1
3: 28
4: 259
Right 1141932539 16:87215768-87215790 GAGAGCTCAACCTCCGTCTTAGG 0: 1
1: 0
2: 0
3: 5
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141932538 Original CRISPR CTCTCCTAACACCTGCAGAA AGG (reversed) Intronic
900372025 1:2336431-2336453 CCCTCCGAACACCTGCAGGTGGG + Intronic
901785012 1:11618800-11618822 CTTCCCTAACACGTGGAGAAAGG + Intergenic
902554274 1:17237847-17237869 CTATCCTGACACCTGCAGGCTGG - Intronic
903757342 1:25671851-25671873 CTCCCCTAGAACCTCCAGAAAGG - Intronic
904329077 1:29746213-29746235 CTTTCCTTCCAGCTGCAGAAGGG - Intergenic
905023422 1:34833731-34833753 CTCCCCTAAAGCCTGAAGAAAGG + Intronic
905260722 1:36716247-36716269 CTCTCCAAACCACTGCAGAGTGG + Intergenic
906792466 1:48670762-48670784 CCCTACAAACACCTCCAGAAAGG + Intronic
907270835 1:53290093-53290115 CTCCCCTGGCGCCTGCAGAAGGG - Intronic
907903108 1:58759838-58759860 CTCTAGTAACACCTCAAGAAAGG - Intergenic
910603957 1:89062964-89062986 CTCTCCTCACATCTTCATAATGG + Intronic
911059612 1:93736520-93736542 CTCTACTAAGCCCTACAGAATGG + Intronic
911944128 1:104084396-104084418 CATTCCCAACACCTGGAGAAAGG - Intergenic
912480290 1:109977835-109977857 CTGTCCTCACTGCTGCAGAATGG + Intergenic
915593444 1:156883381-156883403 CTCTCCTAGCCCCTGCAGAGAGG - Intergenic
916201632 1:162277106-162277128 CTCTCCCCAGACCTGCAGAATGG + Intronic
916794070 1:168149729-168149751 CTCTCCTAAATCCTGGAGAGAGG + Intergenic
916949314 1:169762824-169762846 CTCCCCTAGAACCTCCAGAAAGG + Intronic
917483599 1:175434400-175434422 CTCTCCAACCATCTGGAGAATGG - Intronic
919073772 1:192789618-192789640 CTCTCCAAACACCTATAAAATGG + Intergenic
920387216 1:205577500-205577522 CTCTGCTAACCCCCGCAGAGGGG + Intronic
921033324 1:211353221-211353243 CTCCCCTGACCTCTGCAGAATGG + Exonic
921900031 1:220440347-220440369 CTCTCCTCATACTTTCAGAAGGG - Intergenic
1063094929 10:2900705-2900727 CTCTCCTGACACCTGCTGTTGGG - Intergenic
1064183821 10:13142933-13142955 CTCTCCTCACACCTCCTGACAGG - Intergenic
1065016624 10:21468297-21468319 CTCTCCTAACAAGTGGAGCAGGG + Intergenic
1065441630 10:25758291-25758313 CTCCCCTGAGATCTGCAGAAGGG - Intergenic
1066540989 10:36446828-36446850 CTCCCCTAACAACTGAAGAAGGG + Intergenic
1068525040 10:58118508-58118530 CTCTCATAAAGCCTCCAGAAAGG + Intergenic
1070979714 10:80634380-80634402 CTCTCCTACCGCCTGCAGAAAGG + Intronic
1071671055 10:87609888-87609910 ATCTCCCATCACCTCCAGAAGGG + Intergenic
1072425763 10:95329178-95329200 TTCTCCTAACACCTTTATAAGGG + Intronic
1072798080 10:98371961-98371983 CTCTCCTAACACCTCGAGTGTGG - Intergenic
1075143634 10:119864196-119864218 CTCTCCTAAAGCCTCCACAATGG + Intronic
1076028203 10:127134703-127134725 CTCTTCTGACACATGCAGAAAGG - Intronic
1077671511 11:4161919-4161941 CTCCCCTAAGTCCTCCAGAAAGG + Intergenic
1078120746 11:8506499-8506521 CTCTCCTAAAGCCTCCAGAAAGG - Intronic
1078612202 11:12830423-12830445 CTCTCCTACCAGCTCCTGAAGGG + Intronic
1079096093 11:17511272-17511294 CGCACCTACCACCTGCATAAGGG + Intronic
1080928906 11:36786988-36787010 CTCTCCTAGAGCCTCCAGAAAGG - Intergenic
1083083819 11:60122015-60122037 CTCTCCTATCACCCTCAGATGGG + Intergenic
1084716868 11:70879777-70879799 CTCTCCTGGCACCAGCTGAATGG + Intronic
1084732856 11:71084547-71084569 CTGTTCTAGCACCTGGAGAATGG - Intronic
1085469800 11:76750343-76750365 CCATCATAACACATGCAGAAGGG - Intergenic
1085517011 11:77117463-77117485 CTGACCTGACACCTGCAGAAGGG - Intronic
1087013977 11:93538590-93538612 CTCTGCTAACAGCTAGAGAAAGG - Intronic
1088359821 11:108978367-108978389 CCCTTCTAACTCCTGAAGAATGG + Intergenic
1088713895 11:112531983-112532005 CTCTCCCACCACCTCCACAAAGG + Intergenic
1089161398 11:116440299-116440321 CTCCCCTAGAACTTGCAGAAGGG - Intergenic
1089807140 11:121100732-121100754 CTGTCCTATCTCCTGCAGAGCGG + Intergenic
1091336084 11:134767360-134767382 CTCCACTGACACCCGCAGAAGGG + Intergenic
1091604455 12:1938054-1938076 CTCTCCCAACAACTGGAGCATGG + Intergenic
1092053117 12:5487334-5487356 CTCTCCTAACAGCTGTGCAAAGG + Intronic
1093059876 12:14590595-14590617 CTCACCTAACCCCTGCCAAAAGG - Intergenic
1095545450 12:43362916-43362938 ATCTCCTAAAGCCTCCAGAAAGG + Intronic
1096396348 12:51269702-51269724 CTCTCCTGACACCTGGTGGATGG - Intronic
1098115562 12:67172770-67172792 TTCTCCAAAGACCTGCAGATTGG + Intergenic
1099057520 12:77863327-77863349 TTCGCCTAACATCTGCTGAAGGG - Intronic
1099397547 12:82159424-82159446 TTTTCCTAGCACCTCCAGAATGG + Intergenic
1101759080 12:107644501-107644523 CTCTCAGAATACCTGGAGAAGGG + Intronic
1103857003 12:123978009-123978031 CTCTCATAACACCTGCAAAGTGG - Intronic
1103860040 12:124004860-124004882 GTCTCCCAACACCTCCAGATGGG + Exonic
1105530339 13:21213335-21213357 ATCACCTAACACCTTGAGAAAGG + Intergenic
1105983962 13:25547495-25547517 GTCTCCCATCACCTGCAGATGGG + Intronic
1106616679 13:31336495-31336517 CTCTCCTGCCAAATGCAGAAAGG - Intergenic
1106945468 13:34823030-34823052 CTCTACTAAAAGCAGCAGAAGGG + Intergenic
1109075095 13:57824071-57824093 CTTTCCTGCCACCTGCAGCATGG - Intergenic
1109770365 13:66962988-66963010 ATCTCCCATCACCTGCAGATAGG - Intronic
1110819696 13:79900238-79900260 CTCTCCTAGAACCTTCAGAAAGG + Intergenic
1112621722 13:101060053-101060075 CTCTCCTAAGACCTGCATGACGG + Intronic
1112722538 13:102260906-102260928 CTTTCCTAACTCCTCCAGAGAGG + Intronic
1113319035 13:109214061-109214083 CTCTCCAAACCCCTCCTGAAAGG + Intergenic
1113417423 13:110138887-110138909 CTCTCCTTACACCTCCACATGGG - Intergenic
1114168201 14:20243505-20243527 TTCTCCGACCAGCTGCAGAAGGG - Exonic
1114423700 14:22604977-22604999 TTCACCCAACACCTGCAGCAGGG + Intronic
1114973881 14:28069595-28069617 CTCAATTAACAACTGCAGAATGG + Intergenic
1115066001 14:29260261-29260283 TTCTCCTAACACCTTCAGTGTGG + Intergenic
1116514904 14:45793321-45793343 ATCCCCTAACACGTGCAGTAAGG + Intergenic
1117235916 14:53774388-53774410 GTCTCCTAACAACTGCAAAAGGG + Intergenic
1117695740 14:58360527-58360549 CCCTACTATCCCCTGCAGAAAGG - Intronic
1118509103 14:66450877-66450899 CTCTCTGCACACCTGCTGAATGG + Intergenic
1120089391 14:80313464-80313486 CTCACCTCACATCTGCAGAAAGG + Intronic
1120925886 14:89796749-89796771 ATCTCCTAATATCTGCAGAGGGG - Exonic
1122502147 14:102207926-102207948 CTCTCTCAACACCAGCAGAGAGG + Intronic
1125879839 15:43184741-43184763 CACTACTGATACCTGCAGAATGG + Exonic
1125920199 15:43520851-43520873 CCCTCATAACACCTCCAGAGTGG - Intronic
1127989978 15:64106806-64106828 CTTTCCTAGAACCTCCAGAAAGG + Intronic
1128014852 15:64334567-64334589 GTCTCCCATCACTTGCAGAAAGG - Intronic
1128783416 15:70377669-70377691 ATTTCCTAGCAACTGCAGAATGG + Intergenic
1130016449 15:80190220-80190242 CTCTCCTTCCTCCTGCAGAGAGG + Intergenic
1130892327 15:88143553-88143575 CTCTTTTAACACCAGCAAAATGG + Intronic
1133285497 16:4688778-4688800 CTCTGCTCCCACCTGCAGGACGG + Exonic
1133654550 16:7847857-7847879 CTCTCCCACCACCAGCACAATGG - Intergenic
1134094053 16:11407188-11407210 ACCTCCACACACCTGCAGAAAGG + Exonic
1134379061 16:13707593-13707615 CTCTCCCATCACCCCCAGAAGGG + Intergenic
1137797883 16:51237542-51237564 GTCTCCTTCCACCTGCAGCAAGG + Intergenic
1137972683 16:53001392-53001414 CTCCCCTAGAACCTCCAGAATGG + Intergenic
1140913768 16:79476888-79476910 CTCTCCTCAGACCTGCACACAGG - Intergenic
1141037797 16:80643508-80643530 CTCTGCTAAGGCGTGCAGAAGGG - Intronic
1141747538 16:85935861-85935883 CTCCCCTAAAGCCTCCAGAAAGG + Intergenic
1141883988 16:86879337-86879359 ATGGCCTGACACCTGCAGAAAGG + Intergenic
1141932538 16:87215748-87215770 CTCTCCTAACACCTGCAGAAAGG - Intronic
1148191390 17:45681144-45681166 CTCTGCCCCCACCTGCAGAAGGG - Intergenic
1151872588 17:76846438-76846460 TTTTCCTAACACCTCCATAATGG + Intergenic
1153321768 18:3780394-3780416 CTCCCCTAGAACCTGCAGAAAGG - Intronic
1153503457 18:5771319-5771341 CCCTCCTTTCACCTGCACAAAGG - Intergenic
1156259068 18:35427787-35427809 CTCTCCTAGAACCTCCAAAAAGG + Intergenic
1157033355 18:43940447-43940469 CTCCCCTAGAACCTCCAGAAGGG - Intergenic
1157613668 18:48974989-48975011 CTCTCCTAACACGGGCAGAGGGG + Intergenic
1158880171 18:61770471-61770493 CTCTCCCAGAACCTCCAGAAAGG + Intergenic
1162567453 19:11451986-11452008 CTCTCCTCTCCCCTGCAGCAGGG - Exonic
1164011045 19:21203674-21203696 CTCTCCTAATAGCTGAGGAATGG - Intergenic
1167278012 19:48550487-48550509 CTCACCTAACAGATGCAGGAAGG - Intergenic
925603242 2:5630129-5630151 CTCTCCTTGAGCCTGCAGAATGG - Intergenic
925639618 2:5974910-5974932 CTCTCCTAAGCCATGCAAAAGGG - Intergenic
926564008 2:14450010-14450032 GTCTCCTGACAGCTGGAGAATGG - Intergenic
926574437 2:14564496-14564518 CTCTCCTAGAGCCTCCAGAAAGG + Intergenic
927094594 2:19738044-19738066 CTCTCTTAGCATCTGCACAATGG - Intergenic
927100392 2:19783562-19783584 GACTCCAAACATCTGCAGAATGG - Intergenic
929111121 2:38405984-38406006 CTCTCCTATCACCCCCAGATGGG - Intergenic
929650529 2:43676319-43676341 CTGTCCTAACGCCTGGAAAATGG - Intronic
932020708 2:68083250-68083272 GTCTCCCATCACCTGCAGATGGG + Intronic
933176223 2:79176318-79176340 CTCTCCTACAGCCTCCAGAAAGG + Intergenic
933284439 2:80369875-80369897 CTCTTCTAGCACCTCCAGAAAGG + Intronic
933452109 2:82467632-82467654 TTCTCCTAGCTCCTCCAGAAGGG + Intergenic
934736062 2:96690469-96690491 CTCTCTGTCCACCTGCAGAATGG + Intergenic
935762272 2:106332372-106332394 GTCTCCTATCACCTCCAGATGGG + Intergenic
936084288 2:109455973-109455995 CTCCCCTAAGACCTGCATGATGG - Intronic
938409501 2:131052441-131052463 CCGTCCTCAAACCTGCAGAAAGG + Exonic
938576525 2:132609370-132609392 CTCACGTAAAACCTGGAGAATGG + Intronic
938644521 2:133317386-133317408 CTCTCCTACCACTTGCTGGAAGG - Intronic
940758904 2:157716026-157716048 CTCTCCTAGAGCCTCCAGAAAGG - Intergenic
941595506 2:167471902-167471924 CTCTCCTACCACCTGGCCAAAGG - Intergenic
943023445 2:182601758-182601780 CTCTGCTAAGAGCTGCAGAGAGG - Intergenic
943197958 2:184779741-184779763 CTCTGCTAGAACCTTCAGAATGG + Intronic
943653370 2:190481185-190481207 GTCTCCTAAAACCTGCTTAAAGG + Intronic
944612547 2:201426331-201426353 CTCTCCCATCACCTCCAGAAGGG + Intronic
947537627 2:230950774-230950796 CTCTCCTTTCACCTGCCGCAAGG + Intronic
947806630 2:232973110-232973132 CTTTCCTAACCCCAGCAGAAGGG + Intronic
948114317 2:235482892-235482914 CTCTCCTAGAGCCTCCAGAAAGG + Intergenic
1170321147 20:15099395-15099417 CTCTCCACACACCTGCAACAAGG + Intronic
1170819340 20:19743118-19743140 CTCTCTTAACACCTGCGGCTCGG - Intergenic
1171301446 20:24064434-24064456 CTCTTCCATCACCTGCAGATGGG + Intergenic
1172444146 20:34984514-34984536 GCCTCCTAACAGCTGCAGGAGGG + Intronic
1172606086 20:36215019-36215041 GTCTCTTAAGAACTGCAGAATGG - Intronic
1172951017 20:38723706-38723728 CTCTCCAAATGCGTGCAGAATGG - Intergenic
1173492716 20:43496231-43496253 CTCTCCTAGAGCCTCCAGAAAGG + Intergenic
1173995957 20:47338813-47338835 CCTTCCAAACACCTGCAGAATGG + Intronic
1174973333 20:55303434-55303456 GTCTCCCAACACCTCCAGATGGG - Intergenic
1175569583 20:60008806-60008828 CACTCCTTAGCCCTGCAGAATGG + Intronic
1175832120 20:61970434-61970456 CTCTCCATTCACCTGCTGAAGGG + Intronic
1176126864 20:63479436-63479458 CTCTCCTAACACCATCACACTGG - Intergenic
1177026929 21:15932070-15932092 CTTTGCTGACACCTGCAGAGTGG + Intergenic
1177447666 21:21218702-21218724 CTCTCCTAGAACCTTCAGAAAGG + Intronic
1177584320 21:23070066-23070088 ATCTCCTATCACCTGCTGATAGG - Intergenic
1177918944 21:27125985-27126007 CTCTGCAATCACATGCAGAAGGG + Intergenic
1178280580 21:31279002-31279024 CTGTCCTTCCACCTGCACAACGG + Intronic
1178792504 21:35713240-35713262 CTCCCCTAAAGCCTCCAGAAAGG - Intronic
1181582619 22:23836623-23836645 CTATCCTACCACCTGCAGTTGGG + Intronic
1183191516 22:36324574-36324596 CCCTCCCAACACCAGCAGAGGGG - Intronic
1183294754 22:37022915-37022937 CTTTCCTCTCACCTGCACAACGG + Intronic
1184190598 22:42892029-42892051 CTCTCCTTCCTCCTGCAGGATGG - Intronic
1184800950 22:46758967-46758989 CTCCCCTAGAACCTCCAGAAGGG + Intergenic
1184921055 22:47606156-47606178 CTCTCCTGACACTGCCAGAATGG - Intergenic
949358187 3:3203623-3203645 CTCACCTCAGACCTGCAGAATGG - Intergenic
950067499 3:10124686-10124708 CTCTCCTAGAGCCTCCAGAAAGG - Intronic
951161472 3:19427877-19427899 CTCTCCTTCCACCTGCAAATAGG - Intronic
953491855 3:43359597-43359619 CTCTCCTCACACTTCCAGAGAGG - Intronic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
955405235 3:58621754-58621776 CTTTCCAAACATCTGCATAACGG + Intronic
956807862 3:72835000-72835022 CTCTCCTAGAACCTCTAGAAAGG - Intronic
958612523 3:96445921-96445943 ACCTGCTAACAACTGCAGAATGG + Intergenic
960875142 3:122288294-122288316 CTCCCCTAAAACATCCAGAAAGG + Intergenic
961889821 3:130121483-130121505 GTCTCCCACCACCTGGAGAAGGG - Intergenic
962454635 3:135553806-135553828 CTCCCCTAACGACTGCAGTAGGG - Intergenic
963307539 3:143669821-143669843 TTCTCCAAAAACCTGAAGAAGGG - Intronic
963665490 3:148180623-148180645 CTCCCCTAGAACCTCCAGAAAGG - Intergenic
964020079 3:151999423-151999445 CACTCCTAAAGCCTGCAGAAAGG + Intergenic
967235854 3:187383044-187383066 CTCCTCTCACTCCTGCAGAAGGG - Intergenic
967681479 3:192369023-192369045 CTCTCCTAACCTATGCACAATGG - Intronic
969277660 4:6147778-6147800 CTCTCCCATCACCTGCTGCAGGG + Intronic
969898126 4:10323786-10323808 CTCTCCTACTTCCTGCTGAAAGG - Intergenic
970268876 4:14321366-14321388 CTCCCCTAAAACCTCCAGAAAGG - Intergenic
970317948 4:14847211-14847233 CACTCCTAACCCCTGCAAATAGG - Intergenic
971917382 4:32890519-32890541 GTCTCCTATCACCTCCAGATGGG - Intergenic
974300811 4:60064994-60065016 CTCTCCTAATACCATCAGATTGG + Intergenic
975177185 4:71301403-71301425 CTCTCCTAACTCCGTCAGACTGG - Intronic
977454070 4:97235518-97235540 CTGTTCCAACACATGCAGAAAGG + Intronic
977659815 4:99570880-99570902 CTCCCCTAAAGCCTCCAGAAAGG + Intronic
979811939 4:125047148-125047170 TTCTTGTAAAACCTGCAGAACGG + Intergenic
980822746 4:138038358-138038380 CTCTCTTATCACCTCCAGTATGG - Intergenic
981701385 4:147610704-147610726 CTCCCCTACAACCTCCAGAAAGG + Intergenic
982058919 4:151583280-151583302 CTCTGCTATCTCCTTCAGAATGG - Intronic
985819211 5:2148382-2148404 CCCTCCTGTCACCAGCAGAAGGG - Intergenic
987697634 5:21353298-21353320 TTCCCCTAAAACCTTCAGAAAGG + Intergenic
988319943 5:29682108-29682130 CTCTTCTGCCACATGCAGAATGG + Intergenic
988754602 5:34233393-34233415 TTCCCCTAAAACCTTCAGAAAGG - Intergenic
989421364 5:41242730-41242752 CTTTCCTGTCACCTCCAGAATGG + Intronic
989526945 5:42464584-42464606 CTCAGCACACACCTGCAGAATGG - Intronic
990853585 5:60236840-60236862 CTCCCTTACAACCTGCAGAAAGG + Intronic
991510147 5:67367074-67367096 CTCTCATAGCACCTGGAGAAAGG - Intergenic
991608203 5:68424189-68424211 GTCTGCTAGCACCTCCAGAAAGG - Intergenic
991742812 5:69699090-69699112 TTCCCCTAAAACCTTCAGAAAGG - Intergenic
991754884 5:69856114-69856136 TTCCCCTAAAACCTTCAGAAAGG + Intergenic
991794385 5:70278828-70278850 TTCCCCTAAAACCTTCAGAAAGG - Intergenic
991822200 5:70574403-70574425 TTCCCCTAAAACCTTCAGAAAGG - Intergenic
991834211 5:70731262-70731284 TTCCCCTAAAACCTTCAGAAAGG + Intergenic
991886765 5:71278370-71278392 TTCCCCTAAAACCTTCAGAAAGG - Intergenic
995179749 5:109219737-109219759 ATCTCCCACCACCTTCAGAAGGG + Intergenic
996612277 5:125396480-125396502 CTCACCTAACACCTCCACAATGG - Intergenic
998305077 5:141068073-141068095 CTTTTCTAAAACCTCCAGAAAGG - Intergenic
998508153 5:142688875-142688897 CTCTCCTAAGAGCTTTAGAAGGG + Intronic
998665797 5:144295907-144295929 CTCCCCTATAACCTCCAGAAAGG + Intronic
999063153 5:148656472-148656494 CTCCCCTAAAGCCTCCAGAAAGG + Intronic
1001535899 5:172497640-172497662 CTCCCCAAATCCCTGCAGAAGGG - Intergenic
1001764442 5:174234335-174234357 CTCTTCTCTCACCTGTAGAATGG - Intronic
1002599360 5:180345523-180345545 ATCTGCTAAAACCTGCAGAATGG - Intronic
1003401158 6:5792227-5792249 ATCACCTAACACCTTGAGAAAGG - Intergenic
1003583058 6:7359981-7360003 CTCCCCTAAGGCCTCCAGAAAGG - Intronic
1005553220 6:26945109-26945131 TTCCCCTAAAACCTTCAGAAAGG - Intergenic
1007203680 6:40132043-40132065 CTCTCCTAGCCCCTTCAGGAGGG - Intergenic
1008322164 6:50129404-50129426 CACTCATAACACCTGCTGATAGG + Intergenic
1009009536 6:57825344-57825366 CTCTCCTAAAAGCTTCTGAATGG + Intergenic
1012435563 6:99211667-99211689 CTCTCCTACAGCCTCCAGAAAGG - Intergenic
1013639493 6:112059378-112059400 CTCCCCTGCCACCTCCAGAAGGG - Intronic
1014103316 6:117535839-117535861 CTCTCCTGACACTTAAAGAAAGG - Intronic
1015231341 6:130918055-130918077 TTCTCCTAACACCAGCATTATGG - Intronic
1015265701 6:131290076-131290098 CTCTACAAAAACCTGGAGAAAGG + Intergenic
1015583917 6:134756259-134756281 CTCTCCTAACTCCTCCATGATGG + Intergenic
1015645069 6:135378125-135378147 GTCTTCTAATACATGCAGAATGG - Intronic
1015894629 6:138005044-138005066 CCCACCTTACACCTACAGAATGG + Intergenic
1016276945 6:142364899-142364921 CTTCCCTAAGACCTGAAGAAAGG - Intronic
1017942609 6:159066253-159066275 TTCTCCAAAGACCAGCAGAAGGG + Intergenic
1018825551 6:167405835-167405857 CTCTCCCCACACCAGCAGAATGG - Intergenic
1018857764 6:167687714-167687736 CACTGCCAACACCTGCAGCAAGG - Intergenic
1019108533 6:169690495-169690517 CTCTGCTGAGACCTGGAGAATGG - Intronic
1020001250 7:4757206-4757228 CTTTCCTAACAGCTGGAGGACGG - Intronic
1022037338 7:26547046-26547068 CTATCCTCACACCTGCAGCCGGG + Intergenic
1023355446 7:39362809-39362831 CTCTCCTGGGACCAGCAGAAAGG + Intronic
1023879749 7:44311768-44311790 CTCTGCTCCCACCTGCAGACAGG + Intronic
1024438801 7:49390590-49390612 CTCTCCTAGAGCCTCCAGAAAGG - Intergenic
1026456144 7:70574251-70574273 CTCTACTAACATCTGAAAAAAGG + Intronic
1031540011 7:122983732-122983754 TTCTGCTCACACCTCCAGAAAGG + Intergenic
1031700357 7:124917842-124917864 CACTCCTAGCACCTGCGAAAGGG + Intronic
1032598939 7:133272281-133272303 CACTCCTAACAGCTACAGAGTGG - Intronic
1032640461 7:133760628-133760650 CTTTCCTAAAAGCTCCAGAATGG - Intronic
1033333567 7:140434470-140434492 ACCTACTAAAACCTGCAGAAGGG + Intergenic
1035123122 7:156585504-156585526 CTCACCTACCACCTGCAGGGAGG + Intergenic
1035759278 8:2057473-2057495 CCCTCCTACCATCTGCTGAATGG - Exonic
1036922787 8:12873845-12873867 CTCTACTAAATGCTGCAGAACGG + Intergenic
1037961699 8:23102794-23102816 CTCCCCTAGCACCTCCAGGAAGG - Exonic
1038635753 8:29285850-29285872 CTCAGCTGACAACTGCAGAAGGG + Intergenic
1039119043 8:34125365-34125387 CTGGCCAAACACCTGGAGAAAGG - Intergenic
1039806736 8:41006405-41006427 CTCTCCTAACACCATCACATTGG - Intergenic
1042192057 8:66196954-66196976 CTCTCCTATCACCTTGACAATGG - Intergenic
1042663747 8:71183533-71183555 CTTTTCTAAAACCTGGAGAAGGG - Intergenic
1042810898 8:72824233-72824255 CTCACCCTACTCCTGCAGAACGG - Intronic
1043018516 8:74970672-74970694 ATCCAGTAACACCTGCAGAATGG - Intergenic
1043501784 8:80865521-80865543 ATCTGATAAAACCTGCAGAAAGG - Intronic
1043548306 8:81339782-81339804 CTCTCCTAACTCCTGCTCACTGG + Intergenic
1043618325 8:82155935-82155957 CTCCCCTAAAGCCTACAGAAAGG - Intergenic
1044216082 8:89612416-89612438 CTCTCCTAATACCTCCTGCAGGG + Intergenic
1044501238 8:92960746-92960768 CTCTCCTAGAGCCTCCAGAAAGG + Intronic
1044560689 8:93609078-93609100 CTCTCCTAGAACCTCTAGAAAGG - Intergenic
1044826734 8:96205739-96205761 CTCACCTCACACCTGCCCAACGG - Intergenic
1044875237 8:96658854-96658876 CTCTCCTAAAGCTTCCAGAAAGG + Intronic
1045188225 8:99858983-99859005 CTCTGCTACCACCTGAGGAAGGG - Intronic
1045762750 8:105629628-105629650 CTCTCCTAGAACCTCCAGAAAGG - Intronic
1048941856 8:139406746-139406768 CACTCCAAACAGCTTCAGAATGG + Intergenic
1048975922 8:139673019-139673041 CCCACCTACCACGTGCAGAACGG + Intronic
1049815429 8:144596944-144596966 CTCTCCTGAGACCACCAGAAGGG + Intronic
1054990199 9:71316672-71316694 CTCTCCCAGAGCCTGCAGAAGGG + Intronic
1055325818 9:75128073-75128095 CTCTCCTTCCACCTAGAGAAAGG - Intronic
1057551082 9:96051206-96051228 CCCTCCAAACACCAGCACAATGG - Intergenic
1057698758 9:97347915-97347937 CTCCTCTCTCACCTGCAGAAGGG + Intronic
1058068902 9:100581845-100581867 CTTTCCTGACACCTGCTGCAGGG - Intronic
1058952573 9:109917240-109917262 CTCCCCTAGAGCCTGCAGAAGGG + Intronic
1059025477 9:110623837-110623859 ATCTCCTCCCACCTGCAGAAGGG + Intergenic
1059894180 9:118841924-118841946 CTCCCCTAAAATCTCCAGAAAGG - Intergenic
1060229161 9:121814309-121814331 CTCGCCAAATACCTACAGAAGGG - Intergenic
1060253819 9:122007688-122007710 CTCAGCTAACAAATGCAGAAGGG + Intronic
1060438065 9:123612952-123612974 CTCTCCTATTACCCACAGAATGG + Intronic
1186280788 X:7990555-7990577 CTCCCCTAAAGCCTCCAGAAAGG + Intergenic
1187714815 X:22092303-22092325 CTCTCCTAACATATGCACAGAGG + Intronic
1189067749 X:37829037-37829059 CTCTCCTAGAAGCTCCAGAAAGG + Intronic
1196032533 X:111106759-111106781 CTCTCCTCACCCCTGCTGAAAGG + Intronic
1196049202 X:111287563-111287585 CTCACCAAACCCCAGCAGAATGG - Intergenic
1197299909 X:124765410-124765432 CTCTCATAGCACCTGCAGTGTGG + Intronic
1198256987 X:134932522-134932544 CTCTCCTTTCACCTGCCGCAAGG - Intergenic