ID: 1141937259

View in Genome Browser
Species Human (GRCh38)
Location 16:87249163-87249185
Sequence CTCCATTTGCAGAAAGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 265}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141937259_1141937265 22 Left 1141937259 16:87249163-87249185 CCATGCCCTTTCTGCAAATGGAG 0: 1
1: 0
2: 1
3: 19
4: 265
Right 1141937265 16:87249208-87249230 CATCCACGAGATTGGGCACTCGG 0: 1
1: 0
2: 0
3: 6
4: 62
1141937259_1141937264 15 Left 1141937259 16:87249163-87249185 CCATGCCCTTTCTGCAAATGGAG 0: 1
1: 0
2: 1
3: 19
4: 265
Right 1141937264 16:87249201-87249223 TGAGATTCATCCACGAGATTGGG 0: 1
1: 0
2: 1
3: 18
4: 140
1141937259_1141937263 14 Left 1141937259 16:87249163-87249185 CCATGCCCTTTCTGCAAATGGAG 0: 1
1: 0
2: 1
3: 19
4: 265
Right 1141937263 16:87249200-87249222 CTGAGATTCATCCACGAGATTGG 0: 1
1: 0
2: 0
3: 7
4: 96
1141937259_1141937267 29 Left 1141937259 16:87249163-87249185 CCATGCCCTTTCTGCAAATGGAG 0: 1
1: 0
2: 1
3: 19
4: 265
Right 1141937267 16:87249215-87249237 GAGATTGGGCACTCGGAGTAAGG 0: 1
1: 0
2: 0
3: 2
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141937259 Original CRISPR CTCCATTTGCAGAAAGGGCA TGG (reversed) Intronic
905810730 1:40911181-40911203 CTCCATTTTGAGTGAGGGCAAGG + Intergenic
907643652 1:56218574-56218596 CTCCAATTGCTGAAAAGTCACGG + Intergenic
909482533 1:76141265-76141287 CTCCATTTCCAGAAAAGAGAGGG + Intronic
910845808 1:91603812-91603834 GTCCTTTTGCAGACAGGGCCTGG + Intergenic
911241863 1:95476398-95476420 CTCCATATGAAACAAGGGCAGGG + Intergenic
913545929 1:119869251-119869273 CTCTATTTTAAGAAAGGTCAGGG - Intergenic
915042011 1:152976313-152976335 TTCCTTTTGCAAAAGGGGCAAGG + Intergenic
915803637 1:158820794-158820816 CTTCATTTCCAACAAGGGCAAGG + Intergenic
915863384 1:159471771-159471793 CTCAGTTGGCAGAAGGGGCAAGG - Intergenic
916384377 1:164250931-164250953 TTCCTTTCGAAGAAAGGGCAGGG - Intergenic
917470661 1:175323417-175323439 CTTCATTTCCACAAAGGGGATGG + Exonic
918622348 1:186620079-186620101 ATCCATTTGTAGTAAGGTCAAGG + Intergenic
920206837 1:204298468-204298490 CTCCATGTGCAGAAAAGACCCGG - Intronic
920789699 1:209078126-209078148 CCCCATTAGCAGCTAGGGCATGG - Intergenic
921896878 1:220411072-220411094 CTCTATTGGAGGAAAGGGCAAGG - Intergenic
923509680 1:234639524-234639546 CCCCATTTTCTTAAAGGGCAGGG - Intergenic
924558041 1:245133982-245134004 CTGCATTTGGAGAAATGGCAGGG + Intergenic
1063189741 10:3682183-3682205 TTTCATTTGCAGAAGGGGCAGGG + Intergenic
1063682177 10:8199284-8199306 CTTCTTTTTCAGAAAGGGCGTGG + Intergenic
1065192034 10:23221348-23221370 GTCCATTTGGAGAAGGGGCCTGG - Intronic
1069717304 10:70529441-70529463 GCCCATTTTCAGAACGGGCAGGG + Intronic
1069792710 10:71033517-71033539 ATCCACATGCAGAAAGGTCACGG - Intergenic
1070059328 10:72967313-72967335 CTCTGCTTGCAGAAAGGGGAGGG - Intergenic
1070888659 10:79926067-79926089 CTCCATTCGAACAAACGGCAGGG - Intergenic
1071434598 10:85635430-85635452 GTCCACTTGCAGTAAGGGCAAGG - Intronic
1073080252 10:100855155-100855177 CTCCAGTTGCACAAAGAACATGG + Intergenic
1073204129 10:101759740-101759762 CGCCTTCTGCAGAAAGGTCAGGG - Intergenic
1073555627 10:104448023-104448045 CTCCATTTCCAGAAAGAGGCAGG + Intronic
1073785033 10:106879674-106879696 CTCCATCTTCAGCAATGGCAGGG - Intronic
1074702652 10:116106080-116106102 CTCCATTTTCAGAACCAGCAAGG - Intronic
1074703372 10:116111285-116111307 CTTCATGTGCAGTGAGGGCAAGG + Intronic
1075306234 10:121370171-121370193 ATTCAATTGCAGAAATGGCATGG + Intergenic
1075473393 10:122711199-122711221 CTCAATTGGCAGAAAAGGCCAGG - Intergenic
1076139865 10:128070284-128070306 CTGCATCTGCAGAGAGGCCAGGG - Exonic
1077625947 11:3771407-3771429 TGCCATTTGAAGAGAGGGCAAGG - Intronic
1078296960 11:10081461-10081483 CTCCATTTAAAGAAATGGCTGGG + Intronic
1078850196 11:15156681-15156703 CTCCATCTGTAGAATGGGGATGG + Intronic
1079578852 11:22037083-22037105 CTCAATTTCCAGGAATGGCAAGG + Intergenic
1080215816 11:29839107-29839129 CTCCATTTACACATATGGCAAGG + Intergenic
1082315921 11:50721665-50721687 CTCTTTTTGCAGAATGTGCAAGG - Intergenic
1083641744 11:64149400-64149422 CTCCATTTGCACCAGGGCCAGGG - Intronic
1084276408 11:68053286-68053308 CTCCATCAGGAGGAAGGGCAGGG + Exonic
1084321351 11:68375151-68375173 CACCAAATGCGGAAAGGGCAAGG - Intronic
1088260172 11:107936207-107936229 CTCCATTTTGAGCAAGGGCTAGG - Intronic
1088912679 11:114203858-114203880 CTCCATTTTCAGAAACAGGAAGG + Intronic
1088933628 11:114377429-114377451 GCCAATTTGCAGAGAGGGCAGGG + Intergenic
1090559728 11:127918783-127918805 ATCCATGTGCAGAATGCGCAGGG - Intergenic
1090829001 11:130408036-130408058 ATCCATCTGCAGAAAGGACAGGG + Intronic
1091345998 11:134854602-134854624 CTCCATGTGCAGAATGTGCAGGG + Intergenic
1091624645 12:2112752-2112774 CACCATGGGCACAAAGGGCAGGG - Intronic
1092024998 12:5232796-5232818 CACCCTTAGCAGAAAGGGCGGGG - Intergenic
1094183912 12:27620560-27620582 CTCTTTGTGCAGAAAGGGAATGG - Intronic
1095878737 12:47109265-47109287 CTCCATTTACAGAGAGAGGAAGG - Intronic
1096037404 12:48484458-48484480 CTTCATTGGCAGAAAGGCCAGGG - Intronic
1096820220 12:54227917-54227939 CTACATCTGCAGCAAGGGTAGGG - Intergenic
1097276034 12:57814218-57814240 CTCCATTTTCTGGAAGGACAAGG + Exonic
1098690317 12:73479911-73479933 CTTCATCTTCAGAAAGGGCCTGG - Intergenic
1100299862 12:93297023-93297045 CTCCCATTGCAGAAAGGGTCTGG - Intergenic
1101288262 12:103338780-103338802 GTGCATTTGCAGAAAGGGGTGGG + Intronic
1102208158 12:111104898-111104920 CTTCTTTTGAAGAAAGGACAGGG + Intronic
1102742214 12:115217840-115217862 CTCCATTTGTTGGAAGGCCATGG - Intergenic
1105704938 13:22962820-22962842 CACACTTTGCAGAAAAGGCAGGG - Intergenic
1105857896 13:24388004-24388026 CACACTTTGCAGAAAAGGCAGGG - Intergenic
1105979464 13:25503536-25503558 CTCCATTTGCACATGGGGCCAGG + Intronic
1106610001 13:31269783-31269805 CTCACATGGCAGAAAGGGCAAGG - Intronic
1107589324 13:41885329-41885351 CTACAGTTTCACAAAGGGCATGG - Intronic
1107821115 13:44286512-44286534 CTGCATTTGGAGAAAGTGCTTGG - Intergenic
1108190025 13:47928860-47928882 CTGCATATGCAGAAAGCACATGG + Intergenic
1108552945 13:51564714-51564736 CTACAGATGAAGAAAGGGCAGGG + Intergenic
1108866773 13:54933347-54933369 CTCCATTTTGAGTAAGGGCTAGG + Intergenic
1110553627 13:76833918-76833940 CTACAATTGCAGAAAAGGTATGG - Intergenic
1113583764 13:111448781-111448803 CTCGATTTACAGAGAGGGCGTGG + Intergenic
1116065049 14:39971716-39971738 CTCCATTTTTAGTGAGGGCAAGG + Intergenic
1116307570 14:43277706-43277728 CTTCATTTGCATAAAGTGTAAGG - Intergenic
1116606914 14:47010954-47010976 ATCCATTTGCAGTAAGAGAATGG + Intronic
1116955194 14:50916046-50916068 GTCCTGTTGCAGACAGGGCAGGG - Intronic
1118049627 14:62012769-62012791 CACCATTTGCAGAATAGCCAAGG - Intronic
1119567423 14:75640660-75640682 CAGCATTTACAGAAGGGGCAAGG - Intronic
1120897010 14:89542421-89542443 CTCCATTTTGAGCAAGGGCTAGG - Intronic
1121659412 14:95623949-95623971 CTCACATGGCAGAAAGGGCAAGG + Intergenic
1121800764 14:96772378-96772400 CTCCCTTTTCAGAAAGGCCCTGG - Intergenic
1122074870 14:99229530-99229552 CTCCATCTGCAAAATGGGGATGG + Intronic
1124255194 15:28135533-28135555 CTCCTTCTGAAGACAGGGCAAGG + Exonic
1124569117 15:30844084-30844106 CTCCTTCTGAAGACAGGGCAAGG - Intergenic
1126111740 15:45179292-45179314 AGCCTTTTGCACAAAGGGCATGG - Intronic
1126581223 15:50244247-50244269 CTCTATTTCAAGAGAGGGCAAGG + Intronic
1128900998 15:71422923-71422945 CTCTGCTTGCAGAAAGGGGAAGG - Intronic
1129052765 15:72796742-72796764 CCCCATCTGCAGAATGGGGATGG + Intergenic
1129114941 15:73360075-73360097 CTGCATCTTCAGAAAGGGGAAGG + Intronic
1129518597 15:76171721-76171743 CTCCATTTGCAGAAAGTATCTGG + Intronic
1129596609 15:76969342-76969364 CTCCATTTTGAGTAAGGGCTAGG - Intergenic
1131883192 15:96880643-96880665 CTCCATTGGCAGAAAGAAGATGG + Intergenic
1133122389 16:3617826-3617848 CTCTAATGGCAGAAAGGGTAGGG - Intronic
1134233032 16:12443842-12443864 CTTCACTTGCAAAAAGGGTATGG + Intronic
1135303400 16:21349732-21349754 CTCCCCTGGCAGGAAGGGCAGGG - Intergenic
1136300148 16:29328926-29328948 CTCCCCTGGCAGGAAGGGCAGGG - Intergenic
1137080211 16:36041042-36041064 CTCTTTTTGCAGAATGTGCAAGG + Intergenic
1138317173 16:56080383-56080405 CTCATTTGGCAGAAGGGGCAAGG + Intergenic
1141937259 16:87249163-87249185 CTCCATTTGCAGAAAGGGCATGG - Intronic
1142024763 16:87806539-87806561 CTCCCTTTGCAGCCGGGGCACGG + Intergenic
1142061880 16:88035696-88035718 CTCCCCTGGCAGGAAGGGCAGGG - Intronic
1145531398 17:24416621-24416643 CTCTTTTTGCAGAAACTGCAAGG + Intergenic
1145554587 17:24753993-24754015 CTCTTTTTGTAGAAAGTGCAAGG + Intergenic
1145603997 17:25473292-25473314 CTCCTTTTGTAGAAACTGCAAGG + Intergenic
1145617048 17:25663180-25663202 CTCCTTTTGTAGAAACTGCAAGG + Intergenic
1145766029 17:27458737-27458759 CTCCACTTCCTGAAAAGGCAGGG + Intronic
1146257926 17:31402326-31402348 CTCCATGTGGTGAAAGGACAGGG + Intronic
1146466915 17:33093694-33093716 CTGAATATGCAGAAAGGACATGG + Intronic
1146904283 17:36608256-36608278 CTCCATTTGCAGCCAGAGGAAGG + Exonic
1146918097 17:36690951-36690973 CTCCTTTTGCTGAAAGGGGCGGG - Intergenic
1146929886 17:36769375-36769397 CTCCATGTCCAGACAGGGCCAGG - Intergenic
1148489585 17:48014472-48014494 CTCTTCTTGCAGACAGGGCAGGG - Intergenic
1149542916 17:57481703-57481725 ACCCCTTTGCAGAAGGGGCAAGG + Intronic
1150871148 17:68911770-68911792 CTCCATTTGGAGAAAGATAAGGG + Intronic
1152585549 17:81187992-81188014 CCCCTTTTGCAGACAGGGCCAGG - Intergenic
1152988656 18:342588-342610 CTGCATGTACAGAAAGGGAAAGG + Intronic
1153929974 18:9869773-9869795 CTCCTTTTACAGAAGGAGCATGG + Intergenic
1155244605 18:23895117-23895139 CTCCATAAGCAGGAAGGGAAAGG + Intronic
1157445133 18:47738763-47738785 TTCCAATGGTAGAAAGGGCAAGG + Intergenic
1157491526 18:48127121-48127143 CCCCATTTGCAAAATGGGGATGG - Intronic
1159036870 18:63285958-63285980 CTGCTGTTGCAGAAAGGACAGGG - Intronic
1161223952 19:3133679-3133701 GTCCCTTTACAGATAGGGCAAGG - Intergenic
1161618621 19:5286566-5286588 CTCACGTGGCAGAAAGGGCAAGG - Intronic
1164254289 19:23513431-23513453 CTCCATTTTGAGAGAGGGCTAGG - Intergenic
1164961526 19:32435141-32435163 CTGCATTTGCACAGAGGGAAAGG - Intronic
1165265862 19:34663618-34663640 CTGCAGTTGAAGAAAGGTCATGG - Intronic
1166066471 19:40362260-40362282 CTCCATCTGCAAAATGGGCATGG - Intronic
1167602059 19:50460028-50460050 CCCCATTTCCAGAAAAGGCTGGG + Exonic
1167952226 19:53036988-53037010 CTCCATGTCCAGAAAGGTGAAGG - Intergenic
1168720268 19:58550881-58550903 CCCCATACCCAGAAAGGGCAAGG - Intergenic
927585011 2:24294898-24294920 CTTCACATGCAGAAAGGGTAAGG - Intronic
929533292 2:42765254-42765276 CTCCATATGCAGACAGGCCTGGG + Intergenic
930372161 2:50515551-50515573 CTAAATTTGCAGAAAAGGAAAGG - Intronic
930760330 2:55027896-55027918 CTGTATTTGGAGAAAGGGAATGG + Intronic
930981204 2:57528383-57528405 TTCCACTTGCAGAAAGGAGAAGG - Intergenic
931808737 2:65833730-65833752 CTCCATTTGCAAAGTAGGCATGG - Intergenic
932062399 2:68519588-68519610 CTCAATTTGCAGGAAGGAAATGG - Intronic
936798511 2:116236815-116236837 GTACATGTGCAGAAAGTGCAGGG - Intergenic
937084379 2:119160924-119160946 CTCCATGTGTAGAATGGGAATGG + Intergenic
937974441 2:127573798-127573820 CTCGAATTGAAGAATGGGCACGG - Intronic
937992436 2:127672169-127672191 CTCCATTTCCAGGAATGCCAGGG + Intronic
939620636 2:144414551-144414573 TTTCATTAGAAGAAAGGGCAGGG + Intronic
939828631 2:147046023-147046045 ATCAATAGGCAGAAAGGGCAAGG - Intergenic
940704434 2:157086112-157086134 CTGCACTGGCAGAAAGGGAAAGG - Intergenic
941915867 2:170813679-170813701 TTCCCTTTGCAGAAAAGGCTTGG + Intronic
945113557 2:206388543-206388565 CTCTATTCACAGAAAGGGCCTGG + Intergenic
946931802 2:224678382-224678404 ATCCATTTGCAGAAACCACAGGG + Intergenic
1172251524 20:33482791-33482813 CTTCATTAGCGGAACGGGCATGG + Intergenic
1173013629 20:39205101-39205123 CTCCATTTGCAGAGTTGACAGGG - Intergenic
1174557244 20:51404691-51404713 CTGCATTTTCAGAATGGGCAGGG + Intronic
1174993771 20:55543029-55543051 CTGCATTTGCAGAAAGACAAGGG + Intergenic
1175131183 20:56790863-56790885 CTACATGTGCAGGAAGTGCAAGG + Intergenic
1175206338 20:57314601-57314623 AGCCATTTGGAGAAAAGGCAAGG + Intergenic
1175259423 20:57665213-57665235 CTTCATCTGCAAAATGGGCATGG - Intronic
1175381258 20:58565995-58566017 CTTCCTTTGCAGGAGGGGCAGGG + Intergenic
1176265103 20:64205149-64205171 CTCCATCTGCAGAGTGGGCAGGG - Intronic
1177760772 21:25400051-25400073 TTCCACTTGCAGAAAGGAGAGGG + Intergenic
1178385283 21:32144011-32144033 CTCAACTTGCAAAAAAGGCAAGG + Intergenic
1179229594 21:39489432-39489454 TTCCAGTTGCAGGAAGGGCCTGG + Intronic
1179382349 21:40911205-40911227 CTGCATTGGCAGAAATGGCCTGG - Intergenic
1179472430 21:41620582-41620604 TGCCACTTGCACAAAGGGCAAGG + Intergenic
1179625750 21:42648759-42648781 CTCCTTTTGCACAAAAGTCAAGG + Intergenic
1180889152 22:19272937-19272959 CTCCCTTTACAAAAAGGGCTAGG - Intronic
1181610133 22:24006549-24006571 CTCCATTGCCAGGAAGGGCCTGG + Intergenic
1181881837 22:25987162-25987184 GTCCATTTGCAGAGAGGAGAGGG + Intronic
1183072112 22:35403397-35403419 CTCCAGCTGGAGAAAGGGAAGGG - Exonic
1183099621 22:35575762-35575784 CTCCAATGCCAGAAATGGCAGGG + Intergenic
1183235643 22:36614869-36614891 CTCCATGTGCAGTAAGTCCACGG - Intronic
1183309443 22:37101501-37101523 CTCCTCTTCCAGACAGGGCAGGG + Intronic
1184094463 22:42309128-42309150 CCTCATTTGCAGAGTGGGCATGG - Intronic
1184568775 22:45309600-45309622 CCTCATTTGCAGAAAGGGGGCGG - Exonic
1184880489 22:47301189-47301211 CTCCATTTGCAGGAAATACAAGG - Intergenic
1185123854 22:48993057-48993079 CTCCATGGGCAGAAAGAGCAGGG - Intergenic
1185280312 22:49967038-49967060 CTCTGTCTGCAGAAAGGGGAAGG + Intergenic
949393314 3:3587369-3587391 CTCCATTTGCAGAAGGGGAATGG - Intergenic
949435028 3:4019862-4019884 CCTCATTTGCTGAAAGGGAAAGG + Intronic
950147967 3:10665233-10665255 CTCCATAAGCAAGAAGGGCATGG - Intronic
951076763 3:18402836-18402858 CTCCATCAGCAGAGAGGGCAAGG + Intronic
951266220 3:20570382-20570404 CTCCATTTTGAGAGAGGGCTAGG - Intergenic
952669115 3:35944883-35944905 TTCCATTAACAGAAAGGGGAAGG + Intergenic
953311436 3:41883942-41883964 CTCCATTTACAGACGGGCCAAGG - Exonic
953575026 3:44106123-44106145 CTCCTTTTACATAATGGGCATGG + Intergenic
954965027 3:54602891-54602913 CTCACATTGCAGAAAGGGCCTGG + Intronic
956736997 3:72245696-72245718 CTCCATCTGCTGTAATGGCATGG - Intergenic
957899678 3:86473130-86473152 CTCCATTGACAGAGAGGGCCAGG + Intergenic
960153476 3:114274733-114274755 CTCTGCTTGCAGAAAGGGGAAGG - Intergenic
960804585 3:121571526-121571548 CTCCATGTGCATAAATGGGAAGG + Intronic
962353088 3:134670003-134670025 CTCTCATTGCAGAAAGGGCAAGG - Intronic
963311809 3:143717887-143717909 GTCCATTTGCAGATAAGGAAAGG + Intronic
964057026 3:152473297-152473319 CCCCATTAGGAAAAAGGGCAAGG + Intergenic
965272480 3:166636722-166636744 CTGCATTTGGAGATAGGGTAGGG - Intergenic
965850831 3:173020723-173020745 CCCCATTTGGTGATAGGGCATGG - Intronic
966083946 3:176043645-176043667 CGTCATGTGTAGAAAGGGCAAGG + Intergenic
966619468 3:181947959-181947981 CTCCCTGTCCAGAAAGGGCCTGG - Intergenic
966780601 3:183580948-183580970 CCCCATTTGCAGAAATCTCAGGG - Intergenic
969449666 4:7265847-7265869 CTCCCTCTGCAGGAAGGGAATGG - Intronic
973581781 4:52351104-52351126 CTCCATTTTGAGTGAGGGCAAGG - Intergenic
974492539 4:62585658-62585680 CTCATGTTGCAGAAGGGGCAAGG - Intergenic
975183433 4:71373562-71373584 TTAAATTAGCAGAAAGGGCATGG + Intronic
977409011 4:96637455-96637477 TACCATTTGAAGAAAGGCCACGG - Intergenic
979593611 4:122508312-122508334 CTCTCTCTGCAGACAGGGCAGGG - Intergenic
980641976 4:135592680-135592702 CCCCATTTGAAGATAGGTCAAGG + Intergenic
981301573 4:143192642-143192664 CTCACTTGGCAGAAAGAGCAGGG + Intronic
983443024 4:167812199-167812221 CTCCATTTCCAGAAATGCCTTGG + Intergenic
984652601 4:182286539-182286561 CTGCATCTACAGAAAGGGCTGGG - Intronic
988726309 5:33929905-33929927 CTTCACTTGCAGAATGGGCTCGG + Intergenic
988911906 5:35851905-35851927 CTCCATTTGCACAGAGGACTGGG + Intergenic
989013922 5:36906177-36906199 CTTCATTCGCAGAAATGGTAGGG - Intronic
990314680 5:54572941-54572963 CTCCATTTTGAGTAAGGGCTAGG + Intergenic
991920981 5:71656662-71656684 CTCCATGTGCAGAAATGCCAAGG - Intronic
992009371 5:72511532-72511554 CTTCATCTGTAAAAAGGGCAGGG - Intergenic
994417336 5:99489061-99489083 ATCATTTTGTAGAAAGGGCAGGG + Intergenic
994462626 5:100086105-100086127 ATCATTTTGTAGAAAGGGCAGGG - Intergenic
996550217 5:124722651-124722673 CTCCCTTTTGAGAAAGGGCAGGG + Intronic
997224012 5:132195244-132195266 CTCCCTGTGAAGAAAGGACAGGG - Intronic
1006089568 6:31620614-31620636 CTTAATTTGCATAAAGGGCGGGG - Intergenic
1007046380 6:38779126-38779148 CTCCCTGTGCTGAAAGGGAAAGG - Intronic
1007774617 6:44218024-44218046 TCCCATTTGCAGGGAGGGCAGGG - Intergenic
1008014817 6:46506538-46506560 CTCCATTTGCAGGAGGTGAATGG + Intergenic
1008060717 6:46993854-46993876 CACCATTTACAGAAAGGGAGAGG - Intergenic
1008476125 6:51937715-51937737 CTCCATCTGTAAAATGGGCATGG + Intronic
1009259606 6:61467995-61468017 GTCCATTGGCAGAATGGACAAGG - Intergenic
1011114592 6:83875966-83875988 CTCCATTTTGAGAGAGGGCTAGG - Intronic
1015439464 6:133231706-133231728 CTCCATGAGCAGACAGAGCATGG + Intergenic
1016644826 6:146394515-146394537 CTCCAGAAGCAGAAAGGGCATGG - Intronic
1017882215 6:158569859-158569881 CTGCAATCCCAGAAAGGGCATGG - Intronic
1018374222 6:163195713-163195735 CTCCATTTCCCGGCAGGGCAGGG - Intronic
1018444017 6:163838612-163838634 TGCCATTTACAGAAAAGGCAAGG + Intergenic
1019268372 7:131804-131826 CACCATTTCCAGGAAGGGCCAGG + Intergenic
1019873269 7:3787357-3787379 CTTCATTTGCAGAAAAGCAAAGG + Intronic
1020055451 7:5114753-5114775 CTCCATTCCCAGAAAGGGTGGGG + Intergenic
1020590941 7:10136220-10136242 CTCACATAGCAGAAAGGGCAAGG - Intergenic
1020679618 7:11220607-11220629 CTCACTTGGCAGAAAGGGCAAGG + Intergenic
1021297816 7:18930644-18930666 TTTGATTTGAAGAAAGGGCATGG + Intronic
1024257895 7:47551949-47551971 GTGCATTTGCAGAGAGGCCAAGG - Intronic
1024863962 7:53881246-53881268 CTTCTTATGCAGAGAGGGCATGG + Intergenic
1025569878 7:62548901-62548923 CTCCTTTTGTAGAAACTGCAAGG - Intergenic
1026079070 7:67201026-67201048 CTCTATTTCCCTAAAGGGCATGG + Intronic
1026293502 7:69029830-69029852 CTCCATATCCCGACAGGGCAGGG - Intergenic
1026884764 7:73933699-73933721 CTCAAATGGCAGAAAGGGGAGGG + Intergenic
1026915139 7:74115621-74115643 CTCCATTTGCAAAGAGCGGATGG + Intronic
1031979575 7:128116018-128116040 CTGCATTTGCAGAGAGGGGCAGG - Intergenic
1032107774 7:129049118-129049140 CTGCATTTGAAGAAAGGGTTGGG + Intronic
1033040085 7:137909653-137909675 CTCCATTGGAAGAAGGGACAAGG - Intronic
1033444431 7:141407985-141408007 CTCCTTTTCCAGAAAAGGAATGG + Intronic
1035459551 7:159030631-159030653 CTCCGTTTGCAGGAAGGACTGGG + Exonic
1035865610 8:3078195-3078217 TTCCTTGTGCAGAAAGGTCAAGG + Intronic
1036082303 8:5570627-5570649 CTACATTTGCAGCAAGGGAGTGG + Intergenic
1036711599 8:11082991-11083013 CTGCCTGTGCAGAAAGGGCTGGG - Intronic
1036928402 8:12929818-12929840 GTCCATGTGCCGACAGGGCAGGG + Intergenic
1036965229 8:13289841-13289863 TTCCATATGCAGACATGGCAGGG - Intronic
1045520045 8:102895550-102895572 ATCCATTTACAGCATGGGCATGG + Intronic
1048234520 8:132676422-132676444 CTCCATTTGCAGAAAAAGGAGGG + Intergenic
1048460060 8:134614154-134614176 CTCCATTAGGAGAAAGTGCTAGG + Intronic
1048520102 8:135145967-135145989 ATCCATATGCAGAAAGAGAATGG - Intergenic
1048979628 8:139696419-139696441 CACCATTTGCAGGAAGGAGATGG + Intronic
1050720599 9:8584730-8584752 CTCCATTTGCAGCATGAGAATGG - Intronic
1051478779 9:17537646-17537668 CTCCATGTGCAGGAAAGCCAGGG - Intergenic
1054363016 9:64196888-64196910 GTCCATTGGCAGAATGGACAAGG - Intergenic
1055608679 9:77998128-77998150 GCCCATGTGCAGGAAGGGCAGGG + Intronic
1057565630 9:96164004-96164026 CCTCACTTGAAGAAAGGGCATGG - Intergenic
1057794084 9:98143283-98143305 CTCCATTGCCAGAAAGGGAGAGG + Intronic
1058027178 9:100154464-100154486 GTACATTTGCAGGCAGGGCACGG - Intronic
1058227982 9:102390636-102390658 CTCTTTCTGCAGCAAGGGCAGGG - Intergenic
1058548910 9:106092273-106092295 CTTCACTTGGCGAAAGGGCAAGG + Intergenic
1059207371 9:112479487-112479509 CTCCAGTGGCAGAAAGAGCAAGG - Intronic
1061383199 9:130271785-130271807 CTCCCTTAGCTGACAGGGCAAGG + Intergenic
1061512024 9:131067362-131067384 CTCCATGTCCAGAAAGCACAAGG + Intronic
1061655946 9:132090195-132090217 CTCTATCTGCAGAAAAGGCCAGG + Intergenic
1062423488 9:136495251-136495273 CTACATTTCAAGAACGGGCAGGG + Exonic
1062693198 9:137856357-137856379 CTCTATGTGGAGAGAGGGCATGG + Intronic
1185818053 X:3174663-3174685 TTTCAATTGCAGAAATGGCAAGG + Intergenic
1186153463 X:6701085-6701107 CTCCATTAGCAGTGGGGGCAAGG - Intergenic
1186164919 X:6817483-6817505 CTCAATTTGCAGAAACCTCAAGG - Intergenic
1187370268 X:18699667-18699689 CTTCATCAGCAGAAAGGGAAAGG - Intronic
1189099249 X:38172019-38172041 CTCCATTTGCTGGCATGGCAAGG + Exonic
1189380238 X:40497562-40497584 CTGCATTTCCAGAATGGGAAGGG - Intergenic
1189385945 X:40536993-40537015 CTCACATGGCAGAAAGGGCAAGG - Intergenic
1190456118 X:50629213-50629235 CTCCATTTGCAGCAAGCGGTGGG - Intronic
1192321659 X:70095020-70095042 CTGCTTTTGCAGAAACAGCAAGG + Intergenic
1193393069 X:80952174-80952196 CCCCATTTGCAGAACAGCCAAGG - Intergenic
1194492390 X:94568075-94568097 TTCCACTTGCAGAAAGGAAAAGG - Intergenic
1197289888 X:124642360-124642382 TTCCATTTTCAGAAAGGATAAGG - Intronic
1199654820 X:149983832-149983854 GTCCATTTGCCAGAAGGGCAAGG - Intergenic
1199988168 X:152967347-152967369 ATCCATTTGCAGAAAGGTGAAGG + Intronic
1201385138 Y:13432302-13432324 CTTCATTTTCAGAAATGGGAGGG - Intronic