ID: 1141939108

View in Genome Browser
Species Human (GRCh38)
Location 16:87262915-87262937
Sequence CATCAAAGGGATACCGTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 156}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141939104_1141939108 -3 Left 1141939104 16:87262895-87262917 CCCAGACTGCAGGCGGAACACAT 0: 1
1: 0
2: 1
3: 2
4: 84
Right 1141939108 16:87262915-87262937 CATCAAAGGGATACCGTGTGAGG 0: 1
1: 0
2: 0
3: 6
4: 156
1141939099_1141939108 21 Left 1141939099 16:87262871-87262893 CCAGAGAGGTATCCTGCGCCAGC 0: 1
1: 0
2: 0
3: 2
4: 59
Right 1141939108 16:87262915-87262937 CATCAAAGGGATACCGTGTGAGG 0: 1
1: 0
2: 0
3: 6
4: 156
1141939103_1141939108 3 Left 1141939103 16:87262889-87262911 CCAGCTCCCAGACTGCAGGCGGA 0: 1
1: 0
2: 1
3: 13
4: 240
Right 1141939108 16:87262915-87262937 CATCAAAGGGATACCGTGTGAGG 0: 1
1: 0
2: 0
3: 6
4: 156
1141939105_1141939108 -4 Left 1141939105 16:87262896-87262918 CCAGACTGCAGGCGGAACACATC 0: 1
1: 0
2: 0
3: 3
4: 84
Right 1141939108 16:87262915-87262937 CATCAAAGGGATACCGTGTGAGG 0: 1
1: 0
2: 0
3: 6
4: 156
1141939100_1141939108 9 Left 1141939100 16:87262883-87262905 CCTGCGCCAGCTCCCAGACTGCA 0: 1
1: 0
2: 1
3: 28
4: 289
Right 1141939108 16:87262915-87262937 CATCAAAGGGATACCGTGTGAGG 0: 1
1: 0
2: 0
3: 6
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141939108 Original CRISPR CATCAAAGGGATACCGTGTG AGG Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
908445441 1:64195556-64195578 CATGAGAGGGATTCCGTGTAAGG - Intergenic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
913998199 1:143668711-143668733 CATGAAAGTGAGACCTTGTGAGG - Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
917376264 1:174351052-174351074 CATGAGAGGGAGACCGTGGGGGG + Intronic
919281512 1:195495736-195495758 CATCAAGGGATTACCTTGTGGGG - Intergenic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922988373 1:229884439-229884461 CATCAAAAGGATACAATGTTGGG + Intergenic
923280703 1:232440442-232440464 CAGCAAAGGGATACATGGTGTGG - Intronic
923386718 1:233472242-233472264 CAGCAAAGGGATATGGGGTGGGG - Intergenic
924943591 1:248829775-248829797 CATCAGAGGGAGACCGTGCAGGG - Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064876021 10:19995344-19995366 CATAAAATGCATACCGTGTGTGG - Intronic
1068637517 10:59363331-59363353 ATTCAAAGGGATAGCGTTTGCGG - Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069117536 10:64526754-64526776 AAGCAAAGGCATACCGTGAGTGG + Intergenic
1070608898 10:77919804-77919826 CATCACAGACATACCGTGGGCGG + Intronic
1071386176 10:85123626-85123648 CAACAAAGGGAGACCATGTTGGG + Intergenic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1073058865 10:100720843-100720865 CTTCAAAGGGACAGCCTGTGAGG + Intergenic
1075013347 10:118893216-118893238 CATGGAAGGGATCCCGTGGGAGG - Intergenic
1075640590 10:124061543-124061565 CAACAATGGGAAACTGTGTGGGG - Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1086652351 11:89308234-89308256 CAGCAAAGGGATAAAGTGTGTGG + Intergenic
1087185542 11:95189190-95189212 CATCAAAGGCCTACAGGGTGAGG - Intronic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1090298696 11:125614404-125614426 CATCAGAGGAATACCCAGTGAGG - Exonic
1090791338 11:130092683-130092705 CATGAGAGGGAGACCGTGGGGGG + Intronic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091459370 12:632327-632349 CATCAAACGGCTACCGTGTTTGG - Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1099513970 12:83572360-83572382 CATCAAATGGCTACAGTGGGAGG + Intergenic
1102742847 12:115223395-115223417 CTTCAAAGGGATGCCCTGGGTGG - Intergenic
1105314299 13:19243147-19243169 CATCAAAGGATCACCCTGTGGGG + Intergenic
1110829997 13:80019696-80019718 CATCACAGGGATTTCGTGTACGG - Intergenic
1112063316 13:95764116-95764138 CCTGAAAGGTATACCATGTGAGG + Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1117438700 14:55741198-55741220 GAGTAAAGGGAGACCGTGTGCGG + Intergenic
1120973259 14:90227303-90227325 CATCAAAGACACACCGTATGTGG + Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126911585 15:53422564-53422586 CATCACGGGGAGACTGTGTGTGG + Intergenic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1140686330 16:77436838-77436860 CATCAAAAGGATAGCCTGAGGGG + Intergenic
1141939108 16:87262915-87262937 CATCAAAGGGATACCGTGTGAGG + Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1155075912 18:22355069-22355091 CATCAAAGAGGTGGCGTGTGAGG - Intergenic
1157597200 18:48871103-48871125 CATCAAGGGCATAGGGTGTGGGG - Intergenic
1157785971 18:50482971-50482993 CAGGAAAGGGATAAAGTGTGTGG - Intergenic
1158758418 18:60354373-60354395 CATCAAATGAATACAGTCTGTGG - Intergenic
1159619539 18:70621397-70621419 ATTCAAAGGGCTACAGTGTGGGG - Intergenic
1160556119 18:79726680-79726702 CATCAAAAAGAGGCCGTGTGGGG - Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1163534035 19:17866773-17866795 CAACAAAGGGATGGTGTGTGTGG - Intergenic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166262834 19:41653378-41653400 CATCAAGGGAACACCCTGTGGGG + Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
932659829 2:73642375-73642397 CATCCAGGAGATACCGTCTGGGG + Exonic
932666395 2:73702051-73702073 CATCCAGGAGATACCGTCTGGGG + Intergenic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
938253272 2:129833044-129833066 CATCAGAGGGAGACTGTGGGGGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
938586012 2:132691322-132691344 CAGCAAAGGGAAACCATCTGAGG - Intronic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1173217701 20:41101590-41101612 CATCAAATGTATACTGTGTGGGG - Intronic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961706104 3:128786633-128786655 CATCATAGGGATACAGAGTTCGG - Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968852966 4:3095498-3095520 CATCAGAGGGAGACTGTGCGAGG + Intronic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
973244427 4:47995824-47995846 CATCAAGGGAACACCCTGTGGGG - Intronic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979499045 4:121418312-121418334 CATAAAGGGAATACCCTGTGAGG - Intergenic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
985495767 5:204205-204227 CAGCAAAGGGAGAGGGTGTGTGG - Exonic
987414271 5:17646993-17647015 CATCAAGGGAACACCCTGTGGGG - Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
991923793 5:71683964-71683986 CATCACAGGGATCCCTTGGGAGG + Intergenic
995855286 5:116585288-116585310 CATCAAAGAGAAGCCATGTGAGG - Intergenic
998296554 5:140975224-140975246 CATAAGAGGGATTCCATGTGAGG - Intronic
1001890031 5:175331095-175331117 CATCATAGGGATGCCGGATGAGG + Intergenic
1005569110 6:27127387-27127409 CAACAAAGGGCTACCCTGAGAGG - Intronic
1006432492 6:34006297-34006319 CATCAAAGTGACACCATGTTGGG + Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1014648244 6:124003020-124003042 AATGAAAGGGATGCCGTGGGAGG - Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1023301407 7:38776044-38776066 CTTCAAAGGGAGACTGGGTGTGG + Intronic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026500490 7:70939397-70939419 CATTAATGGGATAAGGTGTGAGG - Intergenic
1029090037 7:98040801-98040823 CATCATAGGGTTACCGTGGCTGG - Intergenic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1041721875 8:60983561-60983583 CATCCAAAGGATAGGGTGTGAGG + Intergenic
1044241062 8:89889041-89889063 CAACAAAGTGAGACCCTGTGTGG + Intergenic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1048763718 8:137824743-137824765 CAGCAAAGGGAGATCGGGTGGGG + Intergenic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1054809616 9:69424691-69424713 TATCTCAGGGAGACCGTGTGAGG - Intergenic
1054833873 9:69655993-69656015 CATGTATGGGATACAGTGTGAGG - Intronic
1056465765 9:86852891-86852913 TATTAAAGGAATACAGTGTGTGG + Intergenic
1061299563 9:129697045-129697067 CCTCATAGGGTTACCGTGTGTGG + Intronic
1061845397 9:133385338-133385360 CCTCACAGGGATACCATGGGGGG - Intronic
1187152416 X:16693445-16693467 CATCGAAGGAATGCCGTTTGTGG - Exonic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1195459698 X:105110424-105110446 CATGAAAGGGGTTCCATGTGTGG - Intronic
1196893602 X:120311919-120311941 AATCAAAGGGATGGTGTGTGTGG + Intergenic
1197852178 X:130874293-130874315 CATCTAGGGGATAGAGTGTGAGG + Intronic
1198329966 X:135613279-135613301 CATCAGAGGGATATCCTGTGGGG + Intergenic
1199905590 X:152226102-152226124 CATGCAAGGGATCCCATGTGTGG + Intronic
1200252007 X:154558834-154558856 CATCAAAGGGTCACAGAGTGCGG - Intronic
1200265761 X:154645582-154645604 CATCAAAGGGTCACAGAGTGCGG + Intergenic