ID: 1141939572

View in Genome Browser
Species Human (GRCh38)
Location 16:87265892-87265914
Sequence GATCACCAGCTTCCAAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 171}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141939564_1141939572 -2 Left 1141939564 16:87265871-87265893 CCCTCTTGTAGGCCCCATGCTGA No data
Right 1141939572 16:87265892-87265914 GATCACCAGCTTCCAAGGGAGGG 0: 1
1: 0
2: 2
3: 14
4: 171
1141939562_1141939572 11 Left 1141939562 16:87265858-87265880 CCGTGGCTCTACTCCCTCTTGTA 0: 1
1: 0
2: 0
3: 22
4: 334
Right 1141939572 16:87265892-87265914 GATCACCAGCTTCCAAGGGAGGG 0: 1
1: 0
2: 2
3: 14
4: 171
1141939561_1141939572 19 Left 1141939561 16:87265850-87265872 CCTCTCTGCCGTGGCTCTACTCC 0: 1
1: 0
2: 0
3: 20
4: 173
Right 1141939572 16:87265892-87265914 GATCACCAGCTTCCAAGGGAGGG 0: 1
1: 0
2: 2
3: 14
4: 171
1141939565_1141939572 -3 Left 1141939565 16:87265872-87265894 CCTCTTGTAGGCCCCATGCTGAT 0: 1
1: 0
2: 0
3: 3
4: 93
Right 1141939572 16:87265892-87265914 GATCACCAGCTTCCAAGGGAGGG 0: 1
1: 0
2: 2
3: 14
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141939572 Original CRISPR GATCACCAGCTTCCAAGGGA GGG Intronic
901604418 1:10448220-10448242 GATGACCAGCATCCAAGGCAAGG - Intronic
901622253 1:10597993-10598015 GATCAGCATCTTCAAAAGGATGG - Intronic
902045461 1:13520631-13520653 GAACAGCAGCTTAGAAGGGATGG - Intergenic
903025332 1:20425998-20426020 GATTAGCAGGTGCCAAGGGATGG + Intergenic
904193753 1:28768352-28768374 GATTACCACCTCCCTAGGGAAGG + Intronic
904926985 1:34057238-34057260 GACCACAACCTTCCAAGGGCTGG + Intronic
905641946 1:39596124-39596146 GATCACGAGACTCCCAGGGAGGG - Intergenic
906144155 1:43550177-43550199 CCTCTCCAGCCTCCAAGGGAGGG + Intronic
912836168 1:112998313-112998335 GATCACCAGCTTCTACCAGAGGG + Intergenic
914336932 1:146724197-146724219 GCTCTGAAGCTTCCAAGGGAGGG + Intergenic
915835204 1:159171216-159171238 GATCCCCAGTTGCCAAAGGATGG + Intergenic
916084786 1:161260519-161260541 GATCACAAACTCCCAGGGGATGG - Intronic
916841517 1:168606530-168606552 GATTACCAGCGGCCTAGGGAAGG + Intergenic
918148474 1:181778639-181778661 GAGTACCAGCTTCCTATGGAAGG - Intronic
1067508433 10:46875990-46876012 GAGGACCAGCTGCCAAGGAAGGG + Intergenic
1067653816 10:48175859-48175881 GAGGACCAGCTGCCAAGGAAGGG - Exonic
1069566350 10:69465963-69465985 TAGCACCAGCTTCCCAGGGCAGG + Intronic
1070554812 10:77519289-77519311 TATCACCAGCTGCCAATGGAGGG - Intronic
1070734083 10:78851679-78851701 GATGTCCTGCTTCAAAGGGAAGG + Intergenic
1072977793 10:100074366-100074388 GGTGACCAGCTTCCCAGAGATGG + Intronic
1076268185 10:129127218-129127240 GTTCCCCAGCTACCAAGGGTTGG - Intergenic
1076383285 10:130039415-130039437 GAGCACCAGCATCCGAGGGCAGG + Intergenic
1080063666 11:27984329-27984351 GATCACCAGCTACAAATGGGTGG + Intergenic
1081862621 11:46342175-46342197 GGTCCCCAGCTTCCCAGGGCTGG + Intronic
1084470629 11:69357110-69357132 GTGCACCAGCTCCCATGGGAGGG - Intronic
1084634842 11:70384916-70384938 GCTCACCAACTTCCATGGGTGGG - Intergenic
1085063541 11:73471125-73471147 GATTCCCAGCTTCTAAAGGAAGG + Intronic
1087168477 11:95026845-95026867 GAACCCCAGCTTCCAGTGGAAGG - Exonic
1088011126 11:105002113-105002135 GATCACCTGCCTGCAAGGAATGG - Exonic
1088129588 11:106471642-106471664 GGTCAGCAGCTTCCACTGGATGG - Intergenic
1088539105 11:110894522-110894544 GACCATGAGCTTCCAAGGGCAGG + Intergenic
1089500885 11:118930537-118930559 GAACAGCACCTTCCTAGGGAAGG + Intronic
1094091036 12:26650259-26650281 GATCAGCAGTTGCCAGGGGATGG + Intronic
1102299336 12:111759519-111759541 GTCCCCCAGCCTCCAAGGGAGGG - Intronic
1102554348 12:113717045-113717067 AAACTCCAGGTTCCAAGGGAGGG - Intergenic
1108276496 13:48815633-48815655 GCTCATCAGCAACCAAGGGATGG + Intergenic
1108436119 13:50403217-50403239 TATCACCAGCTTCCCAGCAAAGG - Intronic
1111399066 13:87708468-87708490 GACCATGAGCTTCCTAGGGAGGG + Intergenic
1112101803 13:96197781-96197803 GATCTCCAGCTTTCATGGGCTGG + Intronic
1112333396 13:98494561-98494583 GCTAAACAGCTTCCAAAGGAAGG + Intronic
1112540317 13:100304490-100304512 GATTAAATGCTTCCAAGGGAGGG - Intronic
1113481186 13:110622929-110622951 GATCAACAGCTGCAAATGGAGGG - Intronic
1113564107 13:111308329-111308351 GGGCAGCGGCTTCCAAGGGAAGG - Intergenic
1118492248 14:66272581-66272603 GATCAGCAGCTCCCCAGGGCAGG + Intergenic
1121269841 14:92630840-92630862 GGTCACAAGCTTCTAAGTGATGG - Intronic
1121755847 14:96401408-96401430 GATCCCAACCTTCCAAGGGAGGG - Intronic
1122325345 14:100878316-100878338 GATCTCCAGGTTCAAAGGCAGGG - Intergenic
1122342039 14:101034786-101034808 GATCACCAGCATCAGAGAGATGG + Intergenic
1122977995 14:105178880-105178902 GAGTACCGGTTTCCAAGGGAAGG + Intronic
1124422765 15:29537188-29537210 GATCAACTGGTCCCAAGGGAGGG + Intronic
1126228203 15:46295934-46295956 GATGAGCAGCTTCCTAGGCAGGG - Intergenic
1126493608 15:49266190-49266212 GATCTCCAGCTTCCAAGAGCAGG + Intronic
1129719556 15:77870681-77870703 GATCACCAGGTGCGCAGGGAAGG - Intergenic
1129990691 15:79959893-79959915 TATCAACAGCTTCCAGGGAAAGG + Intergenic
1130651905 15:85766835-85766857 GCTCACCAGCATGCAAGGGATGG - Intronic
1132667938 16:1090482-1090504 GAGCACCATCTCCCAAGGGCAGG + Exonic
1132744046 16:1429409-1429431 GACCCCCAGCTTCCAGGGAAGGG - Intergenic
1138536251 16:57661949-57661971 CATCACCTCCTTCCAAGGTAAGG + Exonic
1139997339 16:70993122-70993144 GCTCTGAAGCTTCCAAGGGAGGG - Intronic
1140878161 16:79172605-79172627 GATCACCAGATTCCGAGGGAGGG - Intronic
1141072692 16:80972676-80972698 GTTCTTCAGCTTCCAAGAGATGG + Exonic
1141939572 16:87265892-87265914 GATCACCAGCTTCCAAGGGAGGG + Intronic
1141961664 16:87413147-87413169 CATCACCAGCTGCCCCGGGAAGG - Exonic
1143862196 17:9899061-9899083 GGTCAACAGTTTCCCAGGGAGGG - Intronic
1147442314 17:40454675-40454697 GGACCCCAGCTTCCAAGGGCAGG - Intronic
1147557458 17:41488566-41488588 CATCACCAGCTCCCAAAGGCAGG + Intronic
1148093592 17:45037326-45037348 GATCACCAGCCTCAGAGAGATGG - Intronic
1149331736 17:55589611-55589633 GATCACCAGATTCCAGGGGGAGG - Intergenic
1151054179 17:71012703-71012725 GATCAACAACTTCAGAGGGATGG + Intergenic
1151342651 17:73481717-73481739 GAGCCCCAGCGTCCAAGGGCAGG - Intronic
1151869479 17:76826771-76826793 ATTCACCAGCTTCCAGGAGATGG + Intergenic
1151967663 17:77439824-77439846 GAGGCCCAGCTTCCAGGGGAAGG - Intronic
1153996228 18:10444294-10444316 GATCCCCAGCTTGCTAGTGATGG + Intergenic
1154031725 18:10759010-10759032 GATCACCAGCTGCCATGGGAAGG + Intronic
1154394149 18:13971357-13971379 GCTCACTAGCTTCCCAGAGATGG - Intergenic
1155522679 18:26685057-26685079 ATTCACCAGCTTCCATGGAATGG - Intergenic
1157461848 18:47904316-47904338 GATCCCCTGCCTCAAAGGGAAGG + Intronic
1157854235 18:51090378-51090400 GATCAGTAGTTGCCAAGGGAGGG + Intergenic
1160351060 18:78178780-78178802 GATTAGCAGCTGCCAAGGGTTGG - Intergenic
1161743329 19:6039281-6039303 GATCAGCAGTTGCCAAGGGCTGG + Intronic
1162109777 19:8393710-8393732 TAGGACCAGCTTCCAGGGGAGGG + Intronic
1162127809 19:8508762-8508784 TAAAACCAGCTTCCAAGGGATGG + Intergenic
1162211180 19:9093474-9093496 GCTCACCAGCATCTTAGGGATGG - Exonic
1164862040 19:31569230-31569252 GATCTCCAGCTTCTATGGAAAGG - Intergenic
1167868761 19:52350039-52350061 GAACACCAGTCTCCATGGGAGGG - Intronic
1168235296 19:55059215-55059237 GATGACCGTCTTCCCAGGGATGG + Exonic
1168493658 19:56832651-56832673 GGTCACCAACTTCAAGGGGAGGG + Intronic
927336223 2:21927889-21927911 AATCACCACCTGTCAAGGGAGGG + Intergenic
928238152 2:29563314-29563336 GATCACTAGATTCCACGGGGTGG + Intronic
929708872 2:44245884-44245906 GAGCACCAGCTCCAAAGGAATGG - Intergenic
930164074 2:48186502-48186524 ATTCACCAGCTAACAAGGGAAGG + Intergenic
930631825 2:53761483-53761505 GATCTCCAGTATCCAAGGGCAGG - Intronic
934663720 2:96156408-96156430 GTTCACCATCTTCCAGGGGCTGG + Intergenic
934860955 2:97763309-97763331 GAGCACGGGCTTCCAAGGGAAGG - Intronic
934919312 2:98330115-98330137 AGTCACCATCTTCCAAGGGAGGG + Intergenic
935648705 2:105363710-105363732 GATCCCCAGCATCCCTGGGAAGG - Intronic
937754081 2:125515311-125515333 GCTGCCCAGCCTCCAAGGGAGGG + Intergenic
945276745 2:207995459-207995481 GACCACTAGCTTCCAAAGTAAGG + Intronic
946134672 2:217636056-217636078 GAAAGCCAGCTTCAAAGGGAAGG - Intronic
946156809 2:217812378-217812400 AATGACCAGCTTGCAAGGCAGGG + Exonic
948147195 2:235716674-235716696 GATGAGCAGCTTCCCAGAGAAGG + Intronic
949068978 2:242012088-242012110 GACCAACAGCTTCCCAGCGATGG + Intergenic
1171245514 20:23607056-23607078 TCTCACCAGCTTCCAGAGGATGG + Intergenic
1172612548 20:36262600-36262622 GAGCACCAGCTCTCCAGGGAAGG + Intronic
1173183957 20:40825480-40825502 GATGACCAGCATCCAAATGATGG + Intergenic
1174343263 20:49911255-49911277 GCTTACCAGCTTACCAGGGAGGG - Intronic
1174538323 20:51269912-51269934 TAGCACCAGGTTCCAAGTGAGGG + Intergenic
1178573637 21:33764499-33764521 GATCAGCAGTTGCCAGGGGATGG + Intronic
1178794561 21:35731996-35732018 GATCTCCTGCTTCCCAGAGAGGG - Intronic
1178883548 21:36467114-36467136 GATCACCAGCTCTGAAGGGAGGG + Intronic
1178911927 21:36681703-36681725 AATCACCAGGTGTCAAGGGAGGG + Intergenic
1179057469 21:37949400-37949422 GATCAGTAGCTTCCAGGGGTTGG + Intergenic
1179264695 21:39792905-39792927 GAACACCAAATTCCATGGGAAGG + Intronic
1179553061 21:42155514-42155536 CACCACTAGCTTCCTAGGGAGGG + Intergenic
1179720525 21:43313801-43313823 GCTCACCTGCTGCCCAGGGAGGG + Intergenic
1181103722 22:20558872-20558894 GATCACCAGCCTTGAAGGGAAGG + Intronic
1183367999 22:37417380-37417402 GAGAGCCAGCTTCCAGGGGAAGG - Intronic
1183615207 22:38940227-38940249 GAACACCAGTTTCCAGTGGAGGG - Intergenic
1183830266 22:40415138-40415160 GAACTCTAGCTTCTAAGGGATGG - Intronic
1183904437 22:41029783-41029805 GACCAGCAGCTTCAAAGTGATGG + Intergenic
1184297487 22:43534131-43534153 AATCACCAGTTGTCAAGGGAGGG + Intronic
1184466116 22:44669500-44669522 TATCCCCACCTGCCAAGGGATGG - Intronic
1184829639 22:46976319-46976341 GATCAACGGCTGCCACGGGACGG - Intronic
1185306789 22:50122611-50122633 GATCAGGAACTTCCAAGGGAAGG - Intronic
950797008 3:15518377-15518399 AATCACCAGCTTTCAAGTCACGG + Intronic
951681784 3:25302575-25302597 GATTAGCAGCTTCCAGGGGCTGG + Intronic
952240768 3:31529647-31529669 GAGGCCCAGCTTCCAGGGGAAGG - Intergenic
952828447 3:37543448-37543470 GATGACCACCTTTCAAGGTAAGG - Intronic
953273061 3:41465027-41465049 AGTCACCAGCTCCCAAGGGAAGG + Intronic
954681569 3:52348874-52348896 CATCACCAGCTGCAGAGGGAAGG - Exonic
956909568 3:73803630-73803652 GATCCCCACGTGCCAAGGGAGGG + Intergenic
956946762 3:74232196-74232218 GATCATTAGCTTCAAAGGTAGGG - Intergenic
957257985 3:77863341-77863363 GATCCCCATGTGCCAAGGGAGGG + Intergenic
961202920 3:125058580-125058602 GATCAACAGATTCCCAGGGCTGG - Intergenic
969031807 4:4221619-4221641 GCTCCCCAGCTTCCCAGTGAGGG + Intronic
969033054 4:4228571-4228593 GATCCCCAGCTTCCCAGTGAGGG - Intergenic
972736308 4:41845024-41845046 GCTCACCAGCCTCCAAGGTCAGG + Intergenic
982407850 4:155040439-155040461 CAACTCTAGCTTCCAAGGGAAGG - Intergenic
988893238 5:35642940-35642962 GTTAACCAGCTTGCAAGTGAAGG - Intronic
988960154 5:36362720-36362742 TATCACCAACTTCTAAGGAAAGG - Intergenic
993622362 5:90183745-90183767 TAAACCCAGCTTCCAAGGGATGG + Intergenic
994749419 5:103720417-103720439 GATCACCATGTGCCAAGGGTGGG - Intergenic
996689877 5:126329072-126329094 GAATGCCAGCTTCCAAGGAATGG - Intergenic
997200005 5:132004151-132004173 GATCACTAGCTTCCAGGGCTGGG + Intronic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
997860380 5:137410375-137410397 GGTCATCAGTTTCCAAGGGCTGG - Intronic
998497244 5:142601476-142601498 GATCACCAGCTTCTGATGGGGGG + Intronic
1002826293 6:777208-777230 GAGCAGCAGCTGCAAAGGGAGGG + Intergenic
1004167244 6:13267608-13267630 GATCAACAGTTTCCAAGGACTGG - Exonic
1007120673 6:39377983-39378005 GATCAACAAGTTCCAAAGGATGG - Intronic
1007125168 6:39419785-39419807 GATCACACACTTCCTAGGGAAGG + Intronic
1008064526 6:47033188-47033210 GGGCACCAGCTTCCGTGGGAAGG + Intronic
1011135045 6:84090994-84091016 GATCACCAGAATCCCAGAGATGG - Intergenic
1011980102 6:93364016-93364038 GATTACCAGTTTTCAGGGGATGG + Intronic
1017403357 6:154089951-154089973 GATCACTATCTTGCAAAGGATGG - Exonic
1017634748 6:156432628-156432650 AATTATCAGGTTCCAAGGGAGGG - Intergenic
1019796248 7:3050844-3050866 GATCAGCAGCTTGAAAGGGTGGG + Intergenic
1019913263 7:4114465-4114487 CATCACCAGTTTCCAATGAATGG - Intronic
1021045616 7:15919265-15919287 GATCAGCAGTTTCCAAGGTTTGG - Intergenic
1022089469 7:27098085-27098107 GAGCACCAGCTTCCAGCGGCGGG + Intergenic
1025003336 7:55336650-55336672 TATCCCCAGATTCCAGGGGAGGG + Intergenic
1026361510 7:69605178-69605200 GATCACCAGATTCCAAGATCTGG - Intronic
1026988384 7:74569164-74569186 GAACACCAGCTCCTCAGGGAGGG - Intronic
1027714511 7:81653201-81653223 GTCCACCAGCTTCCACAGGAAGG + Intergenic
1029414069 7:100431980-100432002 GAGCAGCAGCCTTCAAGGGAAGG - Intronic
1032520251 7:132538359-132538381 CATCACCAGCTTCACAGGAAGGG + Intronic
1032699846 7:134369839-134369861 TATGACCAACTTCCTAGGGAGGG + Intergenic
1037835202 8:22211504-22211526 GATCCCCAGCTTTGAAGGGCAGG - Intronic
1039101942 8:33950682-33950704 GATGAGCAGATACCAAGGGAAGG - Intergenic
1040452212 8:47559468-47559490 GATGACCAGCTCACAGGGGAGGG - Intronic
1042253789 8:66782647-66782669 GATCAGCAGCTGCCAGGGGCTGG - Intronic
1047750320 8:127875749-127875771 TAGCAACTGCTTCCAAGGGAAGG + Intergenic
1047974230 8:130113311-130113333 GAACACCACGTGCCAAGGGAAGG - Intronic
1049303085 8:141882081-141882103 GATCAACAGCTCCCTAAGGAGGG + Intergenic
1050891821 9:10834191-10834213 GACTACCAGTTTACAAGGGAGGG - Intergenic
1055262084 9:74448927-74448949 GCTCAAGAGCTTCCAATGGAAGG - Intergenic
1055407558 9:75990360-75990382 GCACACCAGTTTCCAAGGGGAGG - Intronic
1055481475 9:76712667-76712689 GGTCACTGGCTTCCCAGGGACGG - Intronic
1056095434 9:83248454-83248476 GATCTCCAGCTCCCCAGTGAAGG - Exonic
1056733375 9:89184421-89184443 GATCACCACCTGCCAAGGATGGG - Intergenic
1057509134 9:95663221-95663243 GGTCACCAGCTTCCCTGGCAGGG + Intergenic
1059711669 9:116873297-116873319 GAAAAACAGCTTCCAGGGGAGGG + Intronic
1060211983 9:121716183-121716205 GGTCACAGGCCTCCAAGGGATGG + Intronic
1189299493 X:39942247-39942269 CATCACCAGCCTCAGAGGGAGGG + Intergenic
1190748423 X:53340750-53340772 GAACACCAGATTCTAAGGAAAGG + Intergenic
1190898920 X:54650266-54650288 ATGCACCAGCTGCCAAGGGATGG - Intergenic
1192564440 X:72151866-72151888 AATCACCAGGTTCCAAAGGCTGG + Intergenic
1196030683 X:111092615-111092637 TATCACCACCATCCAAGGCATGG - Intronic