ID: 1141942485

View in Genome Browser
Species Human (GRCh38)
Location 16:87286891-87286913
Sequence CAAACTAAACACAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 266}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141942481_1141942485 28 Left 1141942481 16:87286840-87286862 CCGCACAGTGGAGGAAAGGAACG 0: 1
1: 0
2: 1
3: 19
4: 158
Right 1141942485 16:87286891-87286913 CAAACTAAACACAAGGAGGAAGG 0: 1
1: 0
2: 3
3: 25
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141942485 Original CRISPR CAAACTAAACACAAGGAGGA AGG Intronic
900685334 1:3944564-3944586 TAAATAAAAGACAAGGAGGATGG - Intergenic
902074846 1:13776160-13776182 CAAGCCACACACAAGCAGGAAGG - Intronic
905894003 1:41533650-41533672 CAAAGGAGACACAAGCAGGAGGG - Intronic
906174291 1:43756746-43756768 CCATCTAAGCACAAGGAGTAAGG + Intronic
906508797 1:46399201-46399223 AAAACAAAACAGATGGAGGAGGG + Intronic
906994621 1:50778662-50778684 CAAACTGAAGAGAAGGAGGAAGG + Intronic
907053704 1:51345857-51345879 CCAACTAAGGACAAGGAGCAGGG + Intergenic
913530167 1:119728293-119728315 CAGACAAAACAAAAGCAGGAAGG - Intronic
913579609 1:120213234-120213256 CAAACTAAGCACAAAAGGGAAGG + Intergenic
913628564 1:120685154-120685176 CAAACTAAGCACAAAAGGGAAGG - Intergenic
914344446 1:146786432-146786454 CAAAGTAGAAACAAGGACGATGG - Intergenic
914413761 1:147457871-147457893 AAAATTAAACAAAAGGAAGAAGG + Intergenic
914561543 1:148824661-148824683 CAAACTAAGCACAAAAGGGAAGG + Intronic
914611289 1:149305547-149305569 CAAACTAAGCACAAAAGGGAAGG - Intergenic
914982080 1:152423950-152423972 CACACTAAAGATGAGGAGGAAGG - Intergenic
918129776 1:181616734-181616756 CAAACAAAAAAAAAGGAGGTGGG + Intronic
918455598 1:184709671-184709693 CAAATAAAATACAAGGAAGAAGG + Intronic
919136400 1:193513162-193513184 CAACCTAGACTCAAGGAGAAAGG - Intergenic
919265486 1:195259030-195259052 CAGTCTAAACTCAAGGAGGTGGG - Intergenic
919366851 1:196672301-196672323 TGAACAAAACACAAGTAGGAAGG - Intronic
920144509 1:203847270-203847292 CAAACTAAACTCAAGACAGAAGG + Exonic
920435282 1:205943240-205943262 CAAGCTGAGCACAAGTAGGAAGG - Intronic
921743091 1:218708602-218708624 CAAACTAACCTCAAGGAGTCTGG + Intergenic
921820463 1:219610912-219610934 CAAACTAAACTCAAGACAGAAGG - Intergenic
921885960 1:220306175-220306197 CAAAATCAACACAAGGAACACGG + Intergenic
922294064 1:224233781-224233803 AAAACTAAACTCAAGAAGAAAGG + Intronic
923321923 1:232842785-232842807 CAAAGGAAACAGATGGAGGATGG + Intergenic
923927182 1:238644981-238645003 CAAACTGAACACACAAAGGAGGG - Intergenic
1062790585 10:301848-301870 CAAACCAGACACCAGGAGGACGG + Intronic
1062836405 10:639018-639040 CAAACTGAATGCAAGGAGGAGGG - Intronic
1063291785 10:4757281-4757303 CAAAGTAAACGCAAGGGGAAGGG + Intergenic
1063817864 10:9797014-9797036 CAAAATAAAAACCAGAAGGAAGG + Intergenic
1065095124 10:22272798-22272820 CAAACAAAAAAAAAGGAGGGTGG - Intergenic
1066798612 10:39156374-39156396 CAGGCTAAAAACAAGAAGGAAGG + Intergenic
1067422600 10:46168197-46168219 CAAATTAAACACAAGTAGAAGGG - Intergenic
1068425574 10:56859284-56859306 CAAACAAAACACAACGAGACAGG - Intergenic
1068659603 10:59610594-59610616 TAAACTAAACATATGGAGGATGG - Intergenic
1068659814 10:59612321-59612343 TAAACTAAGCATATGGAGGATGG + Intergenic
1068922292 10:62497526-62497548 CAAACCAAACACACGTAAGAGGG - Intronic
1069179198 10:65334655-65334677 TTAACTAAATACAAGGAGGTAGG + Intergenic
1070271210 10:74956865-74956887 TAAACTAATCCCAAGAAGGAAGG - Intronic
1071074298 10:81732688-81732710 CAAAAGAAACACATGGAAGAAGG + Intergenic
1073953367 10:108837565-108837587 CAAGCTAAAAATAATGAGGAAGG - Intergenic
1074624887 10:115171899-115171921 CAAACTAAAAACAATAAAGAAGG - Intronic
1076084144 10:127610433-127610455 CTAACTAAACAAAAGCAGAAAGG - Intergenic
1077591096 11:3491602-3491624 AAAACCAAAAACCAGGAGGAAGG - Intergenic
1077966017 11:7134379-7134401 CAAATCAAATACAATGAGGAAGG - Intergenic
1079482266 11:20893883-20893905 CAAACTAAACATGAGAAGGCTGG + Intronic
1081430852 11:42975079-42975101 CCAACTAATCACCAGGAGGAGGG + Intergenic
1082269204 11:50151122-50151144 CAAAATAAAGGGAAGGAGGAAGG + Intergenic
1088344669 11:108809359-108809381 CAACCAACACACATGGAGGAAGG - Intronic
1089226204 11:116924699-116924721 CCAACTACACCCAAGGAGAAAGG + Intronic
1089405369 11:118193091-118193113 CAAACTAAATACAGGCAGTATGG + Intergenic
1092769781 12:11885979-11886001 CAAACTAAACATTATCAGGAAGG + Exonic
1093850093 12:24026109-24026131 TAAAGTAAACACAATGAAGAAGG + Intergenic
1094050071 12:26209703-26209725 CAAAACAAACACATGAAGGAAGG - Intronic
1094244856 12:28277668-28277690 CAAAGTGAAAAAAAGGAGGAGGG - Intronic
1094391471 12:29955580-29955602 CAAAATAATCATAAGCAGGAAGG + Intergenic
1095662304 12:44751632-44751654 CAAAGTAAACACAGGAGGGAGGG - Intronic
1095823972 12:46512189-46512211 CAAAATAAACATAAGGTGGAAGG - Intergenic
1096070785 12:48774417-48774439 AGAAGTAAACACAAGCAGGACGG + Exonic
1096242929 12:49968854-49968876 CTAACTACACACAGGGAGGAGGG + Intronic
1097124076 12:56759472-56759494 CATAATAAACAAAAGGAGAATGG + Intronic
1100604836 12:96143131-96143153 GATACTACACACAGGGAGGAGGG + Intergenic
1105903954 13:24785119-24785141 CAAACTAAACTCAAAGCAGAAGG - Intronic
1106636558 13:31534847-31534869 CAAAAGAAACATAAGGAGGAAGG - Intergenic
1110143534 13:72160688-72160710 CAAAATAAATCCAAGGAGGCTGG - Intergenic
1112152888 13:96783339-96783361 CAAACTAAACATCAGGAGGCTGG + Intronic
1113233653 13:108243323-108243345 CAAAGTAAACACTTGGAAGATGG + Intergenic
1113641340 13:111959465-111959487 CAAACTAACCAAAATGAGGAGGG - Intergenic
1114408771 14:22481101-22481123 CAAATTAATCCCAAGGAGCAAGG + Intergenic
1116192377 14:41677105-41677127 AAAAGTAAAAACAAGGAGAAAGG + Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117111822 14:52465241-52465263 GAAAAGAAAAACAAGGAGGAGGG + Intronic
1119111872 14:71982306-71982328 AAAAATAAACAGAAGGAGGGAGG - Intronic
1119576101 14:75723775-75723797 AAAACTGAACACAAGTAGGGAGG - Intronic
1119697245 14:76722622-76722644 CAATCTAGAAACAAGGAGGTGGG - Intergenic
1120438753 14:84510029-84510051 CAAACTAAACCCAAAAATGAGGG + Intergenic
1121295800 14:92820979-92821001 AAAACAAAAATCAAGGAGGATGG - Intronic
1124024868 15:25956553-25956575 AAAACTAAACTCAAAGATGACGG - Intergenic
1124688384 15:31801173-31801195 CACACTCAACACAGGCAGGATGG + Intronic
1124702836 15:31931615-31931637 AAAACAAAAAACAAGGAAGAGGG - Intergenic
1124816759 15:33001599-33001621 CACTCTAAACTCGAGGAGGAGGG - Intronic
1125211628 15:37222857-37222879 CAAACTAAACAAAAGCACGTCGG - Intergenic
1126241685 15:46452238-46452260 CAAATAAAAAACAAGGAGAATGG - Intergenic
1126508310 15:49434452-49434474 CAAACCCAACACAAGGAGAAGGG + Intronic
1127508841 15:59620526-59620548 CAATATAAACAAAATGAGGATGG - Exonic
1127807973 15:62538592-62538614 AAATCTAAAACCAAGGAGGAAGG - Intronic
1134821982 16:17254272-17254294 CAACATAAAGACAAGGATGAAGG + Intronic
1135929102 16:26721635-26721657 CAAACTCAACATGAGGAGGAGGG - Intergenic
1137276849 16:46940520-46940542 CAAAGTAAACACAATGGAGAAGG + Intergenic
1137435058 16:48448136-48448158 CAAGCTGAACACAGGGAGGTGGG - Intronic
1138271582 16:55699644-55699666 GACACTACACACCAGGAGGAAGG - Exonic
1138722155 16:59094882-59094904 CAGAAGAAACACAAGGAGGGAGG + Intergenic
1139989553 16:70928917-70928939 CAAAGTAGAAACAAGGACGATGG + Intronic
1140102871 16:71933518-71933540 TAAACTGAACAGAAGGAGAAAGG + Exonic
1141942485 16:87286891-87286913 CAAACTAAACACAAGGAGGAAGG + Intronic
1142441662 16:90102383-90102405 CAAACAAAAAAGAAGGAAGACGG + Intergenic
1143152348 17:4815461-4815483 CCAACTCACCACCAGGAGGAGGG + Exonic
1145287445 17:21516845-21516867 CAAACTATAGACTAGGAGAAGGG - Intergenic
1148354521 17:46966950-46966972 TAAGCAAAACACAAGGAAGAAGG - Intronic
1152033900 17:77859943-77859965 CCAACAAGACAGAAGGAGGAAGG - Intergenic
1152387609 17:79984411-79984433 AAAAGTAAACACAAGGCTGAAGG + Intronic
1152409423 17:80115254-80115276 GAAAGAAAACACAACGAGGAAGG - Intergenic
1153137084 18:1929420-1929442 AAAACTGTACAAAAGGAGGAAGG + Intergenic
1154091375 18:11366881-11366903 CAAAATAAATACAAGTAGCAGGG - Intergenic
1155163516 18:23214660-23214682 CAAAAGGAGCACAAGGAGGAAGG - Intronic
1156489943 18:37490249-37490271 CAAACTGAAAACAGGGAGTACGG + Intronic
1158101202 18:53832235-53832257 CAAAATAAACGGATGGAGGAAGG - Intergenic
1159879678 18:73846468-73846490 CAAACAAAAAACAAGCAGGGTGG + Intergenic
1162208285 19:9072276-9072298 AAAACTAAAAACAAGAAGGCTGG - Intergenic
1164530370 19:29043888-29043910 CAAACTAATCACCAGGAGGATGG + Intergenic
1165875377 19:39002897-39002919 AAAACTAAATACAAGGAAAATGG - Intronic
925107267 2:1302409-1302431 TCAACTAAACTCATGGAGGAAGG + Intronic
925477567 2:4234661-4234683 GTAACTAAACACAGGGAGAATGG - Intergenic
927180787 2:20445571-20445593 CAGCCTGAACACAAGCAGGAAGG - Intergenic
928640475 2:33293365-33293387 CAAAATAAACACAGGTAGCAGGG - Intronic
929217169 2:39427246-39427268 CAAAATAAAGACAATGAGGAGGG + Intronic
930403364 2:50921176-50921198 AACATTAAACACAATGAGGATGG + Intronic
930482678 2:51968804-51968826 TTTATTAAACACAAGGAGGAGGG + Intergenic
931093823 2:58917298-58917320 AAGGCTAAACACCAGGAGGATGG - Intergenic
931926441 2:67078087-67078109 CAAAACCAACACAGGGAGGAAGG - Intergenic
931975414 2:67638654-67638676 AAAGCTAAAAACAAGGAGGAAGG - Intergenic
932261816 2:70333285-70333307 CAAACTCTTCACATGGAGGATGG - Intergenic
933484637 2:82903505-82903527 CAAAGTAAACACAAGTAAAACGG - Intergenic
934156865 2:89210099-89210121 CAAACAAAACCCATGGAGTATGG + Intergenic
934210454 2:89972650-89972672 CAAACAAAACCCATGGAGTATGG - Intergenic
934580369 2:95432983-95433005 CAAACTAGCCACAAGAAAGATGG - Intergenic
934599077 2:95643734-95643756 CAAACTAGCCACAAGAAAGATGG + Intergenic
935795277 2:106634917-106634939 CAGACCACACACAGGGAGGAAGG + Intergenic
936096328 2:109532903-109532925 GAAACTAAACAGAAGGAAGCAGG - Intergenic
937146091 2:119646126-119646148 TAAACAATACACAAGGAGGTGGG + Intronic
937190691 2:120094608-120094630 CAAACTAAACCTAAAGTGGAAGG - Intronic
937327237 2:120997720-120997742 CAAACTATACAAAAGGATGTAGG + Intergenic
937713884 2:125010103-125010125 CAGACTAAAGACAATGATGAAGG - Intergenic
938196941 2:129336742-129336764 AAACCAAAACACAAGGAGGGAGG + Intergenic
938548778 2:132360675-132360697 CAAACAAAAAACAAAGAGGGAGG + Intergenic
939635772 2:144581094-144581116 CAAACTGAAAACAAGGGGGAGGG - Intergenic
939727386 2:145739548-145739570 CAATCTGAACACAACGAGGTTGG - Intergenic
941911010 2:170764578-170764600 AAAACTAAACACAAGTTGAAGGG - Intergenic
943895843 2:193358722-193358744 CTGACTAAAACCAAGGAGGAAGG - Intergenic
944218568 2:197279655-197279677 CAAACTAGGAAGAAGGAGGAAGG - Intronic
944654565 2:201864718-201864740 CAAAGGAAACAGAAGGGGGAAGG + Intronic
944814481 2:203361606-203361628 AAAACTAAAAAAAAGGAGAAAGG + Intronic
945045344 2:205776680-205776702 CAAAATGAACCCAAGGAGGATGG - Intronic
945188603 2:207164866-207164888 CAAAAGATACTCAAGGAGGACGG - Intronic
946435858 2:219652950-219652972 CAAACTAAACCCAAAGTGAACGG + Intergenic
946924129 2:224609389-224609411 AAAAAAAAACACAAGAAGGAAGG + Intergenic
1169217515 20:3802108-3802130 CAAAGTGAACCCCAGGAGGAAGG - Intronic
1170415189 20:16132345-16132367 TACACTAAACACAGGAAGGAAGG + Intergenic
1172518448 20:35552118-35552140 CAAACTTAGCACCAGGAGGAAGG + Intronic
1174259757 20:49285386-49285408 CAAACTGTATACAAGGAGTAAGG - Intergenic
1175593370 20:60211665-60211687 CAAAGGAAACACATGGAGAATGG + Intergenic
1176948823 21:15018978-15019000 CAAACTACACATAGGGAAGAGGG - Intronic
1177492972 21:21852608-21852630 CAAACTAAACATAGAGAAGAAGG - Intergenic
1177958107 21:27625846-27625868 GAAGCTAAACACAAGGTGAAGGG + Intergenic
1179827966 21:43978636-43978658 CAAACTACAGACAAGTATGAAGG + Intronic
1181435786 22:22910044-22910066 CTAAGACAACACAAGGAGGACGG + Intergenic
1183004037 22:34885423-34885445 AAAAAAAAACACAAGGAAGAGGG - Intergenic
949727039 3:7061120-7061142 AAATCTTAACACAAGGAGTATGG - Intronic
949972749 3:9424988-9425010 TAAACTAGACACAAGGAAAATGG + Intronic
950827288 3:15837745-15837767 CAAACCCAACACAAGTAGCAGGG + Intronic
953037445 3:39225392-39225414 CCAATTACCCACAAGGAGGAAGG + Intergenic
953521084 3:43644024-43644046 CAAACAAAATACAAGAAGCAAGG - Intronic
954593496 3:51804483-51804505 CAAGATCAACACAAGGAAGAGGG - Intergenic
955098708 3:55825946-55825968 AAAACAAAACAAAAGAAGGAAGG + Intronic
956318218 3:67964218-67964240 AAAACAAAACAAAGGGAGGAAGG + Intergenic
957049772 3:75402387-75402409 CAAAAAAAAAAAAAGGAGGAAGG + Intergenic
957061119 3:75482102-75482124 AAAACCAAAAACCAGGAGGAAGG - Intergenic
958842199 3:99220213-99220235 CAAAGAAAAAACAAGCAGGAAGG + Intergenic
959514258 3:107247989-107248011 CAAAGTATCAACAAGGAGGAAGG + Intergenic
959528942 3:107409728-107409750 CAAACAAAAAGAAAGGAGGAAGG + Intergenic
959844299 3:111015067-111015089 CAAACTAAACACAAGTTTGTCGG + Intergenic
961894930 3:130159087-130159109 AAAACCAAAAACCAGGAGGAAGG - Intergenic
962911628 3:139856246-139856268 CAATCTATGCACAGGGAGGATGG + Intergenic
963077117 3:141357245-141357267 CAAACAACACACAAGAAAGAGGG - Intronic
963514486 3:146291752-146291774 CAAAATAAAGAGATGGAGGAAGG - Intergenic
964147189 3:153478966-153478988 CAAACTAAACAGCAGGAGAGAGG - Intergenic
964826050 3:160829194-160829216 CTAAACAAAAACAAGGAGGAGGG - Intronic
967236636 3:187391216-187391238 GAAACTAAACAGACAGAGGAAGG + Intergenic
967698465 3:192563530-192563552 CAAGCTAAATCCAATGAGGAAGG + Intronic
968361918 3:198153350-198153372 CAAACAAAAAAGAAGGAAGACGG + Intergenic
968445660 4:650924-650946 AAAAATGAAAACAAGGAGGACGG + Intronic
969747836 4:9088008-9088030 AAAACCAAAAACCAGGAGGAAGG + Intergenic
969808878 4:9632541-9632563 AAAACCAAAAACCAGGAGGAAGG + Intergenic
971866322 4:32177068-32177090 CCAAATACACACAAGCAGGATGG - Intergenic
975120206 4:70720068-70720090 CAAAATAAAAAAAAGAAGGAGGG - Intronic
975167394 4:71192675-71192697 AAAACTTAACAGAAGGAAGAGGG - Intronic
975350912 4:73345135-73345157 CAAAATAAAGAAAAGAAGGATGG + Intergenic
977004463 4:91547530-91547552 AAAAGTAAACAGAAGGAAGAAGG - Intronic
977650679 4:99465057-99465079 CCAAGAAAACACAACGAGGAAGG - Intergenic
978973044 4:114834133-114834155 CAAACAAGACAGAGGGAGGAGGG + Intronic
979869674 4:125803449-125803471 TAAACAAAACACAAAGAAGAGGG + Intergenic
982282064 4:153693702-153693724 CACACTAAAGATGAGGAGGAAGG - Intergenic
983029432 4:162781085-162781107 CAAACAAAAACCAAGAAGGAAGG + Intergenic
983266150 4:165510342-165510364 CAAACCAAACCCAAGCAGGATGG - Intergenic
984111279 4:175618305-175618327 CAAATTAAACGCAAAGTGGAAGG + Intergenic
985847169 5:2358958-2358980 CAAAATAAACACCAGTAGGAAGG + Intergenic
986149866 5:5118413-5118435 CAAACAAAAAACAATCAGGAAGG - Intergenic
986750836 5:10786644-10786666 CAACCAAAACACCAGGAGGAAGG + Intergenic
987624362 5:20378412-20378434 CAAACTCCTCAGAAGGAGGATGG + Intronic
988465403 5:31486256-31486278 CAGACGTAACACAAGGAGAAAGG + Intronic
989338464 5:40347957-40347979 CAAACTAGAGACAAGGAGGGCGG + Intergenic
989844540 5:46124651-46124673 CAAGGTAAAAACAAGAAGGAAGG - Intergenic
990496323 5:56351645-56351667 CAAACTAAAGACAAGGAAGGGGG + Intergenic
991979313 5:72215124-72215146 CAAAATTGACACCAGGAGGAAGG - Intergenic
994263711 5:97689557-97689579 AAAAATAAAAACAAGAAGGAAGG + Intergenic
995360373 5:111290023-111290045 CAAATTACACACATGGAAGATGG + Intronic
995456207 5:112354978-112355000 CAAAATAAACAAAAGGAGGAAGG + Intronic
996233386 5:121094743-121094765 AAAACTAAATAAAATGAGGAGGG - Intergenic
996513126 5:124339879-124339901 AAAACTAAAGATAAGGAAGAAGG + Intergenic
997427261 5:133811887-133811909 CCAAGTGAAGACAAGGAGGAGGG - Intergenic
998239803 5:140430102-140430124 AAAACAAAAAACAAGGAGTATGG - Intronic
999749928 5:154620255-154620277 AAAACAAGACAGAAGGAGGAAGG - Intergenic
1002629235 5:180558603-180558625 AAAAGCAAACACAAGAAGGAAGG - Intronic
1002893000 6:1352998-1353020 CAAACTAAAAACAAAGCAGAAGG + Intergenic
1004086914 6:12458612-12458634 AAAACTAAAAACAATCAGGATGG - Intergenic
1006397501 6:33796754-33796776 CTTACTTAACACAAGGAGGCTGG + Intronic
1007013344 6:38438816-38438838 AAAACAAAACAGAAGGAAGATGG + Intronic
1009565175 6:65303650-65303672 CAAACTAAACTCAAGACAGAAGG + Intronic
1010815433 6:80352667-80352689 TAAACTAATCCCAAGGTGGAGGG - Intergenic
1011625403 6:89279245-89279267 CAATCTCAACACGAGGATGATGG - Intronic
1012152980 6:95778819-95778841 CAAAGTAAACAAAAGGAAAATGG - Intergenic
1012575032 6:100784819-100784841 TAAAATAAACAAAAGGAGAAAGG + Intronic
1012897948 6:104973178-104973200 AAAACTAAAGACAGAGAGGATGG - Intronic
1013638964 6:112054470-112054492 AAAACTAAACAAAACGAAGATGG + Intronic
1014257069 6:119171493-119171515 CAAACTTACCAAAAGTAGGATGG - Intergenic
1016234673 6:141848995-141849017 CAATGTAGAAACAAGGAGGAAGG - Intergenic
1016677261 6:146785691-146785713 CAAACTAAACCAAAAGAAGAAGG + Exonic
1017292692 6:152759552-152759574 CATACTTAACACAAGCAGAAAGG - Exonic
1018587788 6:165381825-165381847 CAAACTAAAGAAAATAAGGAAGG + Intronic
1018599288 6:165522256-165522278 CAAAAAAAATTCAAGGAGGAGGG + Intronic
1019253760 7:35372-35394 CAAACAAAAAAGAAGGAAGACGG - Intergenic
1020831405 7:13100258-13100280 CAAACAAAAAACATAGAGGAAGG - Intergenic
1021272152 7:18603122-18603144 CACACTAAACAGAAGGATGTTGG - Intronic
1024595403 7:50929994-50930016 CAAATTAAACTCAAAGTGGAAGG - Intergenic
1024864088 7:53882868-53882890 TAAAATAAACCTAAGGAGGATGG + Intergenic
1026548227 7:71343704-71343726 CAAAATAAACTCTAGAAGGAAGG - Intronic
1027722210 7:81758447-81758469 AAAAATAAACAGAGGGAGGAAGG + Intronic
1028575069 7:92339892-92339914 CAAACTCAAGAAAAGGAAGAAGG - Intronic
1032827546 7:135586455-135586477 CAAATTAAACCCAAGGCAGAGGG - Intronic
1034227259 7:149493795-149493817 GAAACTCAACACAGGGAGAAGGG + Intronic
1034664988 7:152810101-152810123 AAAACAAAAAACAAGGTGGAGGG - Intronic
1036057644 8:5275903-5275925 CAAAGGAAACAGAAGAAGGAAGG - Intergenic
1036370901 8:8162203-8162225 AAAACCAAAAACCAGGAGGAAGG + Intergenic
1036771575 8:11582044-11582066 CAAACAAAACAAAAGAAGGAAGG + Intergenic
1036879993 8:12503433-12503455 AAAACCAAAAACCAGGAGGAAGG - Intergenic
1036959015 8:13223419-13223441 CAAAATAAACACAAAAAGAAAGG - Intronic
1037903575 8:22702571-22702593 CAAAGTTAACATAAAGAGGAGGG - Intergenic
1038510728 8:28132180-28132202 CAAAGTTAACACAAGGAACAAGG - Intronic
1038988828 8:32843700-32843722 CAAACAAAAAACAGGCAGGAAGG - Intergenic
1039708028 8:40027034-40027056 CACAATAAGCACAAGAAGGACGG + Intergenic
1040366985 8:46727687-46727709 CAAAATAAAGGCATGGAGGAAGG + Intergenic
1040847439 8:51858566-51858588 CAAACTAAAAACAGAGAGCAGGG + Intronic
1041093087 8:54321989-54322011 CTAACTAAAAAGAAGGAGGGAGG + Intergenic
1041131424 8:54706261-54706283 AAAAGTAAACAAAAGGAGGTTGG - Intergenic
1041195077 8:55393548-55393570 CAAACCAAACAAAAGCAGAAAGG - Intronic
1041549425 8:59082936-59082958 CAAACAAAAAACAACGATGAAGG - Intronic
1042092159 8:65170312-65170334 CTAACAAAACACCTGGAGGAGGG - Intergenic
1042684897 8:71427283-71427305 CTAACCAAACATAGGGAGGAAGG - Intronic
1043279192 8:78441349-78441371 CAATCAAAACACAAGAAGGTTGG - Intergenic
1044090574 8:87995093-87995115 CAAACAAAAAACAATGAGGCCGG + Intergenic
1045276114 8:100707387-100707409 GAAACAAAACACAAGGGGCAGGG + Intronic
1045975604 8:108127846-108127868 AAAACAAAAAAGAAGGAGGAAGG + Intergenic
1048063361 8:130943459-130943481 AATACTAAACACAGGGAAGAGGG + Exonic
1048094163 8:131273420-131273442 CACAACAAACACAAGGAGAATGG - Intergenic
1051251435 9:15162651-15162673 CAAAGGAAAGACAAGCAGGAAGG + Intergenic
1052136044 9:24911539-24911561 AAAACTAAGCACAAGGATGCAGG + Intergenic
1053752120 9:41267249-41267271 CAAACAAAAAACAAAGAGGGAGG - Intergenic
1054257644 9:62831581-62831603 CAAACAAAAAACAAAGAGGGAGG - Intergenic
1054333675 9:63784142-63784164 CAAACAAAAAACAAAGAGGGAGG + Intergenic
1056967221 9:91174978-91175000 CAAAGTAAACCCAAAGAAGACGG + Intergenic
1057011044 9:91601559-91601581 GAAACGAAAGACAAGAAGGAAGG - Intronic
1057415994 9:94862666-94862688 GAAACCAAAAACAGGGAGGACGG - Intronic
1057477688 9:95417212-95417234 CAAAATAAACACAAAGAGGATGG + Intergenic
1057884779 9:98822070-98822092 CAAACTAGGCAGGAGGAGGAGGG - Intronic
1060148414 9:121270761-121270783 CAAACTATTCACATGGAGTAGGG - Intronic
1062388206 9:136323325-136323347 CAAACCAAACAGGATGAGGAGGG - Intergenic
1062746636 9:138217171-138217193 CAAACAAAAAAGAAGGAAGACGG + Intergenic
1202801119 9_KI270719v1_random:176755-176777 CAAACAAAAAACAAAGAGGGAGG + Intergenic
1186387670 X:9126396-9126418 CTAACTAAAGACAAGGATGAAGG + Intronic
1186749723 X:12609168-12609190 CAATGTAAAGACAATGAGGATGG - Intronic
1187068476 X:15864457-15864479 CAAAAGGAACACAAGGAGGTTGG + Intergenic
1188110234 X:26189299-26189321 CATATTAAACACAAAGAAGAAGG + Intergenic
1188455804 X:30364261-30364283 CAAACCAAACTCAAGGATAATGG - Intergenic
1189138594 X:38577203-38577225 CAAACTAAACACATGCAAAATGG - Intronic
1189157490 X:38773357-38773379 CACACAAAATACAAGGTGGATGG + Intergenic
1189317877 X:40068650-40068672 AAAACTAAAAACAAAAAGGAAGG + Intronic
1189522638 X:41785806-41785828 CAGCCTATACACAAGGGGGATGG - Intronic
1192038936 X:67596581-67596603 CAGACTGAACACACTGAGGAAGG - Intronic
1193143013 X:78048719-78048741 CAAACTGAAAGCATGGAGGATGG - Exonic
1194711186 X:97238202-97238224 CAAAAAGAAAACAAGGAGGAAGG - Intronic
1194813150 X:98411147-98411169 CAACTAAAACACAATGAGGAGGG - Intergenic
1199322071 X:146451687-146451709 CAAATTAAACACAAGCATGCAGG + Intergenic
1200766817 Y:7087255-7087277 CAAATGAAGCACTAGGAGGATGG - Exonic