ID: 1141946586

View in Genome Browser
Species Human (GRCh38)
Location 16:87315018-87315040
Sequence CTTCCACCCTGGACACAGGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 247}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141946575_1141946586 29 Left 1141946575 16:87314966-87314988 CCTACCTGCTTTCGGGGTCTCAG 0: 1
1: 0
2: 0
3: 9
4: 152
Right 1141946586 16:87315018-87315040 CTTCCACCCTGGACACAGGCAGG 0: 1
1: 0
2: 2
3: 35
4: 247
1141946582_1141946586 -5 Left 1141946582 16:87315000-87315022 CCCAGTAAGGCAGTGCTGCTTCC 0: 1
1: 0
2: 0
3: 20
4: 243
Right 1141946586 16:87315018-87315040 CTTCCACCCTGGACACAGGCAGG 0: 1
1: 0
2: 2
3: 35
4: 247
1141946578_1141946586 25 Left 1141946578 16:87314970-87314992 CCTGCTTTCGGGGTCTCAGGGAC 0: 1
1: 0
2: 1
3: 11
4: 107
Right 1141946586 16:87315018-87315040 CTTCCACCCTGGACACAGGCAGG 0: 1
1: 0
2: 2
3: 35
4: 247
1141946583_1141946586 -6 Left 1141946583 16:87315001-87315023 CCAGTAAGGCAGTGCTGCTTCCA 0: 1
1: 0
2: 1
3: 19
4: 179
Right 1141946586 16:87315018-87315040 CTTCCACCCTGGACACAGGCAGG 0: 1
1: 0
2: 2
3: 35
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141946586 Original CRISPR CTTCCACCCTGGACACAGGC AGG Exonic
900620853 1:3586984-3587006 CTTCCTCCTTGCACACAGGTGGG - Intronic
900889138 1:5436739-5436761 TTCCTAACCTGGACACAGGCAGG + Intergenic
901302458 1:8209614-8209636 CTTCCACATTGGCCATAGGCCGG + Intergenic
901494091 1:9611604-9611626 CATCCACCCTGGACAGTGGGGGG - Intronic
901678195 1:10898819-10898841 CTTCCACCCTGGCCTCTGGGGGG - Intergenic
902907747 1:19571240-19571262 CTGCCACCTTGGAAACAGACAGG + Intergenic
903121093 1:21217574-21217596 CCCCCTCCCTGGACACAGGCAGG - Intronic
903216089 1:21844077-21844099 CTTCAACGCTGGATTCAGGCAGG + Intronic
903347073 1:22693357-22693379 CTGTCACCCAGGACCCAGGCTGG - Intergenic
903853029 1:26319661-26319683 CTTCCTGCTTTGACACAGGCAGG - Intronic
904641820 1:31937457-31937479 CTCACACACTGGACACACGCCGG + Intronic
904750258 1:32737424-32737446 GTTCCTCCCTGGGGACAGGCTGG + Intergenic
908356380 1:63327930-63327952 GTTCCTCCCAGGACACAGGCGGG - Intergenic
909235185 1:73143883-73143905 CTTCCACATTGGAGACAGGGAGG + Intergenic
909736647 1:78970475-78970497 CTTGCACCCATGACACAGGGAGG - Intronic
912508591 1:110173323-110173345 CATCCACTCTGGACACAGGGTGG - Intronic
912550651 1:110483326-110483348 CTCCCACCCAGGACCCAGGCAGG + Intergenic
915339791 1:155170593-155170615 CTTGCTCCCTGGACACAGGTTGG + Intronic
915948934 1:160174777-160174799 CTTCAACCCTGGACTCAGGTGGG + Intronic
915950644 1:160187859-160187881 CTTCCACCCTGTACACATTTGGG - Intergenic
916785186 1:168081880-168081902 CTTCCAGACAGGACACAGCCAGG + Exonic
916996055 1:170302447-170302469 CTGCCACCCTCTACCCAGGCAGG + Intergenic
917338529 1:173950137-173950159 GTTCCACTCTGTACCCAGGCTGG - Intronic
919925235 1:202188686-202188708 CTCCCTCCCTGGGCCCAGGCTGG + Intergenic
920366882 1:205452731-205452753 CTTCCACCATAGGCAAAGGCAGG - Intronic
922762915 1:228143519-228143541 CTTCCACCCTGGCGAGAAGCAGG + Intronic
1064537484 10:16372724-16372746 ATTCCAGCCTGGGCACAGACAGG + Intergenic
1067462224 10:46466137-46466159 CCTCAACCCTGGATACAGGCAGG + Intergenic
1067624972 10:47918461-47918483 CCTCAACCCTGGATACAGGCAGG - Intergenic
1068958101 10:62839131-62839153 CTGCCACCCAGGCCACAGACTGG + Intronic
1070798410 10:79230568-79230590 CATGGACCCTGCACACAGGCGGG - Intronic
1073061230 10:100735105-100735127 CTTCCACCCTGAACATAGCGGGG + Intergenic
1073104091 10:101022378-101022400 CATCCACCCTGGACAACAGCAGG + Exonic
1074721287 10:116267434-116267456 CTGCCACCCAGGGCCCAGGCTGG - Intronic
1075611678 10:123859747-123859769 TTTTCACCCTGACCACAGGCAGG + Intronic
1075924203 10:126236895-126236917 CATCCACCCTGGGCATGGGCAGG + Intronic
1077188650 11:1246605-1246627 CTTCCTCCCTGGGCACCGCCTGG + Exonic
1077194953 11:1274842-1274864 CATCCACACCTGACACAGGCGGG + Exonic
1077474105 11:2778365-2778387 CCTCCACTCAGGACACAGCCAGG - Intronic
1077521392 11:3037491-3037513 CTGGCGCCCTGGACACAGTCAGG - Intronic
1078601326 11:12733614-12733636 ATACCACCATGCACACAGGCAGG - Intronic
1080814291 11:35738926-35738948 CTTCCACCATGGAGACTGGTTGG - Intronic
1081725853 11:45328600-45328622 TTTCCAGCCCAGACACAGGCAGG + Intergenic
1082087096 11:48059019-48059041 CTTCCACCCTACAGAGAGGCCGG + Intronic
1084023468 11:66432698-66432720 TTCCCACCCTGGCCACAGGCTGG + Intergenic
1084045272 11:66564513-66564535 CATCCAGCCAGGCCACAGGCAGG - Intronic
1084153201 11:67300782-67300804 CCTCCTCCCTGGGCCCAGGCTGG - Intronic
1084244570 11:67847934-67847956 TTTCCACCGTGGACACAAACAGG + Intergenic
1084322523 11:68381550-68381572 CTTCCTCCCTGCACGCATGCAGG - Intronic
1085509415 11:77080588-77080610 ATTCCATCCTGTACACAGCCAGG + Intronic
1088828666 11:113516855-113516877 CCTCCACCCTGTACCCAGGTAGG - Intergenic
1089311411 11:117560633-117560655 CTGCCACCCTGGCAAGAGGCAGG - Intronic
1089580165 11:119476718-119476740 CTTCCACCCTAGACACAGCTAGG - Intergenic
1091350250 11:134888237-134888259 CTTACACACTGCACACTGGCAGG + Intergenic
1091793941 12:3286777-3286799 CATCCCCCCTCGAAACAGGCTGG + Intergenic
1093711919 12:22336911-22336933 GTCCCACCCTGGACACAGGGGGG + Intronic
1096650073 12:53058243-53058265 CTTCCACCCTGGGGACTGCCTGG - Intronic
1097245944 12:57607596-57607618 CTTACCCCCTGGACACCGGGCGG - Exonic
1103923473 12:124411419-124411441 CTTCCTTCTTGGACCCAGGCCGG + Intronic
1103977575 12:124713473-124713495 CTTCCACCCTGAGCACCGCCGGG + Intergenic
1104193233 12:126504016-126504038 CTACCAGCCTGCACACTGGCTGG - Intergenic
1105327057 13:19380328-19380350 ATTTCACCATGGACCCAGGCTGG + Intergenic
1106546795 13:30737767-30737789 CTCCCTTCCTGAACACAGGCAGG - Intronic
1107389175 13:39945415-39945437 CTGCCAGCCTGAACACATGCAGG + Intergenic
1107411282 13:40160806-40160828 CTTCTGCCCTGGACAGAGGCAGG + Intergenic
1107411608 13:40163284-40163306 AATCCTCACTGGACACAGGCAGG + Intergenic
1109522011 13:63525857-63525879 CTTCCACCCTGGGGAGAGGTAGG + Intergenic
1111468199 13:88644649-88644671 CTTCCACCCATGAAACAGGAAGG - Intergenic
1111976051 13:94968145-94968167 CCTCCACGCTGCACAGAGGCAGG + Intergenic
1116358096 14:43957117-43957139 CTGTCACCCAGGACTCAGGCTGG + Intergenic
1116888294 14:50241719-50241741 CTGTCACCCAGGACCCAGGCTGG - Intronic
1118038140 14:61890248-61890270 CTGCCACCCTGGACAAAAGAGGG + Intergenic
1118500362 14:66356613-66356635 CTACCACCCAGAGCACAGGCTGG + Intergenic
1119609906 14:76052955-76052977 CTTACACCATGGAGACATGCGGG - Intronic
1120900875 14:89574486-89574508 CTTCTACCCAGGAAACAGGGAGG + Intronic
1122409861 14:101520316-101520338 CTCCCACCTGGGACAGAGGCTGG + Intergenic
1122782216 14:104148576-104148598 CTTCCAACCTCTGCACAGGCTGG - Intronic
1122967888 14:105139700-105139722 CGCCCACCATGGACACACGCAGG + Intergenic
1125539325 15:40460682-40460704 TTTCCACCCAGGAGGCAGGCAGG - Intronic
1125717229 15:41826223-41826245 CCTCCACCCTGGACCCCAGCCGG + Exonic
1126484970 15:49170124-49170146 CCTCCTCCCTGGACTCAGCCAGG - Exonic
1127477701 15:59350246-59350268 CTTCCACCCTGAGGAAAGGCAGG - Intronic
1128183047 15:65621793-65621815 CTTCCACCAGGGACACAGAGGGG - Intronic
1128612086 15:69082142-69082164 ATTTCATCCTGGACACAGGCAGG - Intergenic
1128751669 15:70154563-70154585 CTTCCTCCCTGGACATTGGCCGG - Intergenic
1129516851 15:76162247-76162269 CATTCACGCTGGACACTGGCAGG - Intronic
1131177273 15:90217884-90217906 CTTCCATCCAGGCCAGAGGCGGG + Intronic
1131889459 15:96956687-96956709 CTTTCACCCTGGACAGGCGCTGG + Intergenic
1132575708 16:662853-662875 CTTCCAGCCTGGGCAGAGGCGGG + Intronic
1132752572 16:1465565-1465587 CTTGCGCCCTGGACTCGGGCTGG - Intronic
1132885378 16:2180010-2180032 CTTCCACCTTGGCCAAGGGCGGG + Exonic
1133128014 16:3658720-3658742 GTTCCACCCTGAAGGCAGGCTGG + Exonic
1133173054 16:3993556-3993578 CTGCCACCCTGAATTCAGGCAGG + Intronic
1135724771 16:24845971-24845993 CCTCCACGCTGGGGACAGGCAGG - Exonic
1135772147 16:25225726-25225748 CTTCGAAGCTGGACACAGGGTGG + Intronic
1137491297 16:48935290-48935312 TTTCCACTCAGGACAGAGGCAGG - Intergenic
1137547093 16:49411764-49411786 CTGCCACCCTGGACCCAGGCAGG + Intergenic
1137725392 16:50653418-50653440 CTTCAACCCAGGACCCAGACAGG - Intergenic
1138514717 16:57529620-57529642 CTTCCGCACAGGACCCAGGCGGG + Intronic
1138614749 16:58156572-58156594 CATCCCCCCTGGACACCAGCAGG - Intergenic
1139471334 16:67179594-67179616 CCTGCACCCTGGCCCCAGGCTGG - Intronic
1140917752 16:79509108-79509130 CTTTTACCCTGGACACACGTAGG + Intergenic
1141630787 16:85286953-85286975 CTTCCACCCTGGAAAGCGTCGGG + Intergenic
1141918968 16:87122083-87122105 ATTCCACCCTGGCAGCAGGCTGG - Intronic
1141946586 16:87315018-87315040 CTTCCACCCTGGACACAGGCAGG + Exonic
1142137605 16:88458816-88458838 CTGCCACCCTACACTCAGGCAGG + Intronic
1143515666 17:7418137-7418159 TTGCCACCCTGGACACATGTTGG + Exonic
1144677890 17:17173492-17173514 CTGCCACCCTGGATCCAGGAGGG - Intronic
1145816593 17:27799197-27799219 CTTCATCACTGGCCACAGGCAGG + Intronic
1145951164 17:28818496-28818518 CTGTCGCCCTGGAGACAGGCTGG - Intronic
1145961042 17:28886704-28886726 CTTCCACACTGTCCACAGCCTGG - Intronic
1147045210 17:37746269-37746291 CTTCCCCCCTGGTGACGGGCAGG + Intergenic
1147316779 17:39624867-39624889 ATGCCAGCCTGGCCACAGGCTGG + Intergenic
1148083377 17:44979731-44979753 CTCCCAGCCTGGAAACTGGCAGG - Intergenic
1148157744 17:45433054-45433076 CTTTCTCCCTGGAGACAGCCAGG - Intronic
1148738104 17:49876056-49876078 CTTCCACCCCTGATACAGCCAGG + Intergenic
1150388316 17:64777008-64777030 TTTCCACCCTGGCCACAAGGCGG + Intergenic
1150389419 17:64781744-64781766 CTTCCTCCCTGGAGACAGCCAGG - Intergenic
1150658460 17:67055959-67055981 CCTCCTCCATGCACACAGGCTGG + Intronic
1150790025 17:68196158-68196180 CTTCCTCCCTGGAGACAGCCAGG + Intergenic
1150791143 17:68200955-68200977 TTTCCACCCTGGCCACAAGGCGG - Intergenic
1151485803 17:74398761-74398783 CTGCCACCCAGGGCCCAGGCTGG - Intergenic
1151881731 17:76899605-76899627 CTGCCACCCTGGACAGAGGCTGG - Intronic
1152396734 17:80037239-80037261 CTTCCACCCAGGCCCCAGGACGG - Intronic
1152559895 17:81072678-81072700 CTCCCACTCTGAGCACAGGCGGG + Intronic
1153708762 18:7775564-7775586 CAGCCTCTCTGGACACAGGCTGG - Intronic
1153747463 18:8194511-8194533 AATCCACACTGGAAACAGGCAGG + Intronic
1155827069 18:30458971-30458993 TTTCCAGCTTGGACACAGGAAGG - Intergenic
1157147511 18:45179356-45179378 CTCCCACCATGGCCTCAGGCTGG + Intergenic
1159980788 18:74776974-74776996 CTGCCACCCTTGACACAGTAAGG - Intronic
1160451522 18:78969729-78969751 CTGCCGCCCGGGCCACAGGCTGG - Intergenic
1162633058 19:11944039-11944061 CTTCCACCATGGGCACAAGGGGG + Intronic
1163325801 19:16602344-16602366 CTCACACCCTGCACACAGCCTGG + Intronic
1163726912 19:18928254-18928276 CGTCCACCCAGGACACCGTCTGG + Exonic
1163966205 19:20749606-20749628 TTTCCACCGTGGACACAAACAGG + Intronic
1167390794 19:49193638-49193660 CCTCCAGCCAGGCCACAGGCAGG - Intronic
926165148 2:10517880-10517902 CTTGGACACTGGACACAGTCAGG + Intergenic
927176197 2:20410631-20410653 CTTCTTCCCTGGAGTCAGGCCGG - Intergenic
927206608 2:20615188-20615210 CTTCCTCCCAGGACCCAGGGTGG + Intronic
927495007 2:23546235-23546257 CTTCCACCCAGGCAACTGGCAGG + Intronic
929175336 2:38969831-38969853 CTTCCATCCTGCTCAAAGGCAGG - Intronic
929553423 2:42908531-42908553 CTTCCTTCATGGGCACAGGCTGG - Intergenic
929590167 2:43140374-43140396 GATTCACCCTGGACAGAGGCTGG - Intergenic
932577016 2:72968317-72968339 CTTCCACCCTCTACACAAACTGG + Intronic
933068476 2:77829318-77829340 ATACCATCCTGGACACAGGCAGG + Intergenic
934047795 2:88186572-88186594 CTTCCACCCTGCTCACATGTTGG + Exonic
937228988 2:120386054-120386076 CTCCCACCCTGCAGACAGTCTGG + Intergenic
937585058 2:123536731-123536753 CTTCCATCATGGACACAGGAAGG + Intergenic
937988474 2:127649334-127649356 CTGCCACAATGGGCACAGGCAGG + Intronic
938996943 2:136689807-136689829 CTTCCACCCTTGGCAGATGCTGG - Intergenic
939795588 2:146640784-146640806 CTTCCACCCTGAACAGAAGCAGG - Intergenic
940757019 2:157694762-157694784 CTTCCACCATGGACAATGTCAGG + Intergenic
940848582 2:158667031-158667053 TTTCCACCCTGGGCAGGGGCAGG + Intronic
944481249 2:200160007-200160029 CTGCCACAATAGACACAGGCAGG - Intergenic
946301786 2:218828385-218828407 CCTCCACCCTGGCCCCTGGCTGG + Intronic
948107468 2:235427201-235427223 CATGCACCCTGGAGACTGGCTGG - Intergenic
948257413 2:236578204-236578226 CGTCCACCCTGGAGGCAGTCTGG + Intronic
948792841 2:240388196-240388218 CCTTCACCCTGCCCACAGGCAGG + Intergenic
949046493 2:241874750-241874772 GCTCCACCCTGCACAGAGGCTGG + Intergenic
1169391550 20:5195286-5195308 CCACCACCCTGCACACAGTCTGG + Exonic
1169871561 20:10253910-10253932 CTTCCACCCTGCTGACTGGCAGG + Intronic
1170296742 20:14835191-14835213 CTTGCACCTTGGACACATGGGGG + Intronic
1170485363 20:16810298-16810320 CTTCCCCACTGACCACAGGCTGG - Intergenic
1172204284 20:33151520-33151542 CTTCCAGCCTATGCACAGGCAGG + Intergenic
1172439445 20:34955424-34955446 CTTCCACCCTGGACAAAGTTTGG + Intronic
1172959321 20:38787412-38787434 CCTCCAGCCTGGGGACAGGCAGG - Intergenic
1173656060 20:44701074-44701096 CTTCCATCCTGGCCACATGCAGG + Intergenic
1173868427 20:46327626-46327648 CTTCTACCCTGGAAACACCCTGG + Intergenic
1174055473 20:47795296-47795318 GTACAACCCTGGACAGAGGCTGG + Intergenic
1174500132 20:50978240-50978262 CTCCCTCCCTGCACACAGTCCGG - Intergenic
1175174435 20:57102482-57102504 CTTCCACACTGGAGATAGGGGGG - Intergenic
1175299750 20:57934477-57934499 CATCCACACTGGCCACAAGCTGG - Intergenic
1175752027 20:61505273-61505295 TTTCCACCCTCTAGACAGGCTGG - Intronic
1176056791 20:63153045-63153067 CAGCCACACTGGGCACAGGCAGG - Intergenic
1177706685 21:24715019-24715041 CTGCAACCCTGGAGACAGGCAGG - Intergenic
1178880653 21:36447493-36447515 CTTCCTCCCTGGTCACAGCTTGG + Intergenic
1179189340 21:39109397-39109419 TGTCCACCCTGGACACAGTCGGG - Intergenic
1179602982 21:42493284-42493306 CTTCCGCCCTGGACATGTGCTGG - Intronic
1180673138 22:17569039-17569061 CCTCCAGCCTGGCTACAGGCTGG - Intronic
1180747824 22:18103663-18103685 CCTCCACCCTGCCCACAGCCCGG + Exonic
1180899223 22:19358792-19358814 CTTCCACATTGAACACAGGTAGG + Intronic
1180998031 22:19975158-19975180 CCTCCACCCTGGTGACATGCAGG + Intronic
1181633691 22:24164571-24164593 CAGCCACCCTGGACACAGCCTGG + Intronic
1182160332 22:28115190-28115212 CTTCAGCCCGGGTCACAGGCTGG - Intronic
1183187531 22:36300537-36300559 CTCCCACCCATGAAACAGGCAGG + Intronic
1184403426 22:44286755-44286777 CATCCACTCTGGGCACAGGTCGG - Intronic
1184668474 22:46000824-46000846 CTTCCACCCTGGGCAGATGATGG + Intergenic
1185089727 22:48759051-48759073 CTTCCCTCCAGGCCACAGGCGGG + Intronic
1185237536 22:49723617-49723639 CTTCAAGCCTGGACACCTGCGGG - Intergenic
949205956 3:1439530-1439552 CTCCCTTCCTGGACGCAGGCTGG - Intergenic
952815381 3:37442817-37442839 CTTGCACCCTGGGCAAGGGCTGG - Intergenic
953381055 3:42473256-42473278 CTTCACCCCTGGGCACAGGGTGG - Intergenic
955203701 3:56876178-56876200 CTTCCACCTTTTACACATGCAGG - Intronic
955243801 3:57205021-57205043 CTTCCACCCTGGACCCACCATGG + Intronic
958758372 3:98276500-98276522 CTTTCACTCTGGGCACAAGCTGG - Intergenic
960341365 3:116479008-116479030 CTTGCACCCAGGCCACAGGCTGG - Intronic
960410082 3:117312159-117312181 CCTCCACCCTGCAGACATGCTGG + Intergenic
960967631 3:123116216-123116238 GCTGCACCCTGGTCACAGGCAGG - Exonic
962104777 3:132379319-132379341 CTTCCTCCATAGACACAGGGTGG - Intergenic
962362213 3:134752044-134752066 CATCCACCCTCAACACATGCTGG - Intronic
963392794 3:144689894-144689916 GTTCCACCCTTGACACATGGGGG - Intergenic
968062020 3:195733004-195733026 CCTACATGCTGGACACAGGCTGG - Intronic
968605090 4:1531720-1531742 CTCCCTCCCTGCCCACAGGCAGG + Intergenic
968617128 4:1582475-1582497 CCTGCACCCTGCACCCAGGCTGG + Intergenic
969212472 4:5698315-5698337 CTACCACCCTGGAAACTTGCAGG - Intronic
969355038 4:6620300-6620322 CTGTCACCCAGGGCACAGGCAGG - Intronic
969982532 4:11172984-11173006 CTTCCTGACAGGACACAGGCAGG + Intergenic
970612569 4:17739355-17739377 TTTCTACTCTGGACAGAGGCGGG - Intronic
972330824 4:38063239-38063261 TTTGCACCCTGGACACGTGCTGG - Intronic
973133401 4:46676194-46676216 CTTCCTCCCTTGCCACTGGCAGG + Intergenic
973773335 4:54225822-54225844 CTTCCTCGCTGGACCCAGGGAGG + Intronic
974052978 4:56958384-56958406 CTTGCACAATGGACATAGGCTGG - Intergenic
976345288 4:83993259-83993281 CTTGCACCCATGACACAGGGAGG - Intergenic
976398669 4:84583551-84583573 CTTCCAACCAGGACCCAGCCAGG - Intronic
978503413 4:109433391-109433413 CTTCCACCTAGGGCAGAGGCTGG - Intergenic
978558829 4:110010061-110010083 GTTCCACCATAGAGACAGGCTGG - Intronic
982280655 4:153680960-153680982 ATTCCCACCTGGACACAGGGTGG + Intergenic
982822866 4:159966486-159966508 CTGCTACCCTGGGCACAGGTTGG + Intergenic
983556118 4:169060538-169060560 CTGCCATGCTGGACACAGACTGG - Intergenic
984299776 4:177899985-177900007 CTACCACTCTGGACATCGGCTGG + Intronic
984328703 4:178287249-178287271 CTTCCTCCTTGGACAAAGTCTGG - Intergenic
986649059 5:9946149-9946171 CTTTCACCCTGGACATCTGCTGG - Intergenic
986736735 5:10673885-10673907 CTTCCTCCCTGGACCCAGAAAGG + Intergenic
992894351 5:81233562-81233584 CCTCCTCCCTGCACACAGGTGGG + Intronic
995901127 5:117067428-117067450 TTTCCTCCCTGGACCCAGGGAGG - Intergenic
997191472 5:131940765-131940787 CTTCCAGTGTGGACACTGGCCGG - Intronic
997768229 5:136526477-136526499 ATTCCACACTGGACACAGTGAGG + Intergenic
999310009 5:150545817-150545839 CTTCCTCGCTGGACACGGGTGGG + Intronic
1002065875 5:176651425-176651447 CTTCCCCACAGGACACAGCCTGG - Intronic
1004836434 6:19537010-19537032 CTTCCCACCTGGAATCAGGCAGG - Intergenic
1006775631 6:36590348-36590370 CTTCCCTCCTGGAAACAGGCTGG + Intergenic
1007400519 6:41600015-41600037 CTCCCACCCCGGCCCCAGGCTGG + Exonic
1007918717 6:45586638-45586660 CCTCCAGCCTGGACACTGGCAGG + Intronic
1008687430 6:53941323-53941345 CTTCCACCCTGGGTCCAGGGAGG - Intronic
1014450078 6:121572229-121572251 CTTCCACTCTGTGCACTGGCAGG - Intergenic
1015256287 6:131183187-131183209 CTTCCCCCTTGGCCGCAGGCAGG - Intronic
1016842966 6:148543136-148543158 CAACCAACCTGGACACAGACAGG - Intronic
1017753022 6:157506226-157506248 CTTCAACCCTGGACTCAGTCTGG - Intronic
1018060297 6:160084735-160084757 CGGCCACCCTGGACACAGCGTGG - Intronic
1018280670 6:162182127-162182149 TTTCTACCCTGGACAAAGACAGG + Intronic
1019913560 7:4116315-4116337 CCTCCACCCTCGAGACAGCCAGG + Intronic
1020216359 7:6193926-6193948 CCACCACCCTGGACAGAGGCTGG + Intronic
1021139303 7:17004021-17004043 GTTCCACCCAGCCCACAGGCAGG + Intergenic
1021796450 7:24259368-24259390 CTTTAACCCTGGAAGCAGGCTGG + Intergenic
1024498324 7:50072028-50072050 CTACCAGCATGGACACAGACGGG + Intronic
1026877430 7:73887553-73887575 GCTCCAACCTGGAAACAGGCTGG - Intergenic
1027308372 7:76926578-76926600 CTTCCACACAGGACACTGGAAGG - Intergenic
1030021931 7:105283956-105283978 CTTCAACCTGGGAGACAGGCTGG + Intronic
1030077307 7:105747756-105747778 CTTCCACAGTGGACACCAGCTGG - Intronic
1031297251 7:120016296-120016318 GTTCCACCCTGCACAGATGCAGG + Intergenic
1031814910 7:126421824-126421846 CTTTCACCCAGGCCCCAGGCTGG + Intergenic
1031883338 7:127220937-127220959 CTTCCACCCTTGGCCCATGCAGG + Intronic
1032511566 7:132476629-132476651 AATTCACTCTGGACACAGGCAGG - Intronic
1034406177 7:150903748-150903770 CTGCCACCCTGGGCCCTGGCTGG - Intergenic
1035475325 7:159139807-159139829 CTTCCTGCCTAGGCACAGGCTGG - Intronic
1035744856 8:1954597-1954619 CTTCTGACCTGGGCACAGGCAGG - Intronic
1035754676 8:2022546-2022568 CCTCCACCCTGGGCTCAGGCTGG - Intergenic
1039109124 8:34022537-34022559 CTTCCACCCTGGCCTCTGCCGGG + Intergenic
1039444717 8:37621865-37621887 CTTGCACCCTGTTTACAGGCAGG - Intergenic
1042668954 8:71239558-71239580 TTTCAACCCTGTACACAGACTGG - Intronic
1048545540 8:135383538-135383560 CTACCATTCTGGACACAGGTAGG - Intergenic
1049339665 8:142105384-142105406 CTGCTTCCCTGGACACAGGCCGG + Intergenic
1049393272 8:142382874-142382896 CCTCCACCCTGGACGAGGGCCGG - Intronic
1049418536 8:142506426-142506448 CTCTCACCCTGGACACATGGGGG + Intronic
1051262033 9:15273872-15273894 CTTCCCCCCAGGACTGAGGCAGG + Intronic
1056765679 9:89443213-89443235 CTACCCCCCTGGACAGAGGCCGG + Intronic
1056970431 9:91196461-91196483 CCACCACCCTGGCCACAGGGAGG + Intergenic
1057303264 9:93898637-93898659 CTTCCAGCCTGGAGACAGACAGG - Intergenic
1057765234 9:97910966-97910988 CTTCATCCCTAGACGCAGGCAGG + Intronic
1058529545 9:105892073-105892095 ATTCAAACCTAGACACAGGCTGG - Intergenic
1059327429 9:113512696-113512718 CCTGCACCCAGGACCCAGGCTGG + Intronic
1060440282 9:123632494-123632516 ATTCCACCCTGAAGTCAGGCTGG + Intronic
1060549754 9:124479349-124479371 CTTCCACGCTGGACCCTGCCTGG + Intergenic
1061209139 9:129180837-129180859 CTCCCACCCTGGAAACAGATGGG - Intergenic
1062111726 9:134785585-134785607 TTTCCACCCTGGGCTCAGGCAGG + Intronic
1062252365 9:135604771-135604793 CTTCACCCTTGGACACAGGTGGG + Intergenic
1062739323 9:138159425-138159447 CGCCCAGCCTGCACACAGGCAGG + Intergenic
1187609002 X:20920015-20920037 CCTCCTCCCCGGACAGAGGCTGG + Intergenic
1188006704 X:25020790-25020812 CCTCGACCCTGGCCGCAGGCGGG - Intergenic
1188862465 X:35273127-35273149 CTTGCACCCTGGAAGCAGGGAGG + Intergenic
1194155929 X:90388620-90388642 CTTTCACCCAGCACCCAGGCTGG - Intergenic
1199982194 X:152927360-152927382 CTTCCACCCTGGCCAGGGCCTGG - Intronic
1200502276 Y:3965573-3965595 CTTTCACCCAGCACCCAGGCTGG - Intergenic
1201552236 Y:15229678-15229700 CCTCCACTCTGGACACAGTGTGG - Intergenic
1202604753 Y:26629269-26629291 ATTTCACCATGGACCCAGGCTGG - Intergenic