ID: 1141948965

View in Genome Browser
Species Human (GRCh38)
Location 16:87328481-87328503
Sequence TGTCCACTGCTGAGTGTGAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 213}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141948965_1141948969 -1 Left 1141948965 16:87328481-87328503 CCACTCACACTCAGCAGTGGACA 0: 1
1: 0
2: 3
3: 45
4: 213
Right 1141948969 16:87328503-87328525 ACTTGAGGTCACGGCCCAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 95
1141948965_1141948972 7 Left 1141948965 16:87328481-87328503 CCACTCACACTCAGCAGTGGACA 0: 1
1: 0
2: 3
3: 45
4: 213
Right 1141948972 16:87328511-87328533 TCACGGCCCAGGTGGGCTGAGGG 0: 1
1: 0
2: 1
3: 17
4: 221
1141948965_1141948968 -4 Left 1141948965 16:87328481-87328503 CCACTCACACTCAGCAGTGGACA 0: 1
1: 0
2: 3
3: 45
4: 213
Right 1141948968 16:87328500-87328522 GACACTTGAGGTCACGGCCCAGG 0: 1
1: 0
2: 0
3: 5
4: 78
1141948965_1141948967 -10 Left 1141948965 16:87328481-87328503 CCACTCACACTCAGCAGTGGACA 0: 1
1: 0
2: 3
3: 45
4: 213
Right 1141948967 16:87328494-87328516 GCAGTGGACACTTGAGGTCACGG 0: 1
1: 0
2: 1
3: 15
4: 200
1141948965_1141948971 6 Left 1141948965 16:87328481-87328503 CCACTCACACTCAGCAGTGGACA 0: 1
1: 0
2: 3
3: 45
4: 213
Right 1141948971 16:87328510-87328532 GTCACGGCCCAGGTGGGCTGAGG 0: 1
1: 0
2: 2
3: 22
4: 254
1141948965_1141948970 0 Left 1141948965 16:87328481-87328503 CCACTCACACTCAGCAGTGGACA 0: 1
1: 0
2: 3
3: 45
4: 213
Right 1141948970 16:87328504-87328526 CTTGAGGTCACGGCCCAGGTGGG 0: 1
1: 0
2: 0
3: 9
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141948965 Original CRISPR TGTCCACTGCTGAGTGTGAG TGG (reversed) Exonic
900194202 1:1366207-1366229 TGTGAACTGATGAGTGTGAATGG + Intergenic
901850901 1:12014706-12014728 TGTCCACTGGCGAATCTGAGAGG + Intergenic
901911555 1:12462887-12462909 TGGCCAGTGCTGACTGTGAACGG - Intronic
902890329 1:19438698-19438720 TGTCCTCTGCTGAGTCTCACTGG - Intronic
903486587 1:23693856-23693878 TGTCCACTGCACAGTTCGAGGGG + Exonic
903651504 1:24925279-24925301 TGTGAACTGCTGAGTGGGAGAGG - Intronic
903666282 1:25009490-25009512 TGCCCACTGCTGAGGGTCACGGG - Intergenic
904453819 1:30634752-30634774 TGTGCATTGGTGTGTGTGAGTGG + Intergenic
905493427 1:38363315-38363337 TGTTCATGCCTGAGTGTGAGTGG + Intergenic
905692066 1:39950809-39950831 TGTCCACTGTTTAGTGTGTGGGG - Intergenic
907573234 1:55503352-55503374 TTTCAACTGCTGAGGGAGAGGGG + Intergenic
908262376 1:62349321-62349343 TGGGCACTGCTAAGTGAGAGAGG + Intergenic
910806626 1:91194784-91194806 TGTCCTTTGCTGGGTGTTAGAGG - Intergenic
910850935 1:91649315-91649337 GACCCAGTGCTGAGTGTGAGGGG - Intergenic
911255246 1:95625661-95625683 TGTATACTTCTGAGTCTGAGTGG + Intergenic
913668829 1:121075538-121075560 TGCCCACTGCTGAGTCACAGAGG - Intergenic
914020574 1:143862971-143862993 TGCCCACTGCTGAGTCACAGAGG - Intergenic
914659072 1:149770889-149770911 TGCCCACTGCTGAGTCACAGAGG - Intergenic
915690854 1:157689122-157689144 TGTACAATGCTGAGTGCAAGTGG - Intronic
917956195 1:180101555-180101577 TGTCCACTGCTTGGTGTGTGGGG - Intronic
920112747 1:203598650-203598672 TGTCCCCTGCTGGCTGTGTGGGG + Intergenic
920696533 1:208185073-208185095 TGTTCAGAGCAGAGTGTGAGAGG - Intronic
922559887 1:226561642-226561664 TAACCACTGATGAGTGTCAGAGG + Intronic
922761385 1:228134054-228134076 TGTCCACTGCCTGGTGTGTGGGG - Intergenic
924548554 1:245052859-245052881 GGTCCTCTGCTGAGAGTGAATGG - Intronic
1065208117 10:23376039-23376061 TGTCCACTGCTTGGTGTGTGGGG + Intergenic
1070654607 10:78262703-78262725 TGTCATCTGCTGACTGTCAGTGG + Intergenic
1070720780 10:78755455-78755477 TGTCCACTGTGGTGTGTTAGTGG - Intergenic
1075212936 10:120507013-120507035 GGTTTCCTGCTGAGTGTGAGAGG + Intronic
1077166360 11:1141239-1141261 TGACCACTGCTCAGTGTAACAGG + Intergenic
1078349884 11:10583895-10583917 GGTCATCTGCTGAGAGTGAGAGG + Intronic
1081850216 11:46270551-46270573 TGTCCACAGGTCAGGGTGAGGGG - Intergenic
1084745242 11:71165939-71165961 CATCCTCTGCTGAGCGTGAGTGG + Intronic
1085282639 11:75341018-75341040 TGTACACAGCTGAGTGCGCGGGG - Intronic
1085526623 11:77167768-77167790 TGTCTACTGCTGGGGGTGTGTGG - Intronic
1086252168 11:84829033-84829055 TATCCACTACTGAGTGTGGTAGG - Intronic
1086374302 11:86184780-86184802 TGTCCACTGCTCAGTGGGAGAGG - Intergenic
1087688017 11:101287069-101287091 TCTAGACTGCTGTGTGTGAGGGG - Intergenic
1093156512 12:15692382-15692404 TGACCCCTGCTGAATGTTAGGGG + Intronic
1100922779 12:99507845-99507867 TGTCCACTACTCAGTTTAAGAGG + Intronic
1100976022 12:100123459-100123481 TGTCCACTGCTTGGTGTGTGGGG - Intronic
1101531013 12:105573732-105573754 TGTCCTCTGCTGAGTCTGCCAGG - Intergenic
1101581006 12:106040631-106040653 TGCCCCCTGCTGAGTGGGTGGGG - Intergenic
1102802953 12:115752600-115752622 TGACCACTTCTCAGTGTGAGAGG - Intergenic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1104786667 12:131454812-131454834 GGGCCTCTGCAGAGTGTGAGAGG - Intergenic
1107083648 13:36402561-36402583 TGTCCAATGCTGAAAGTCAGGGG + Intergenic
1108307319 13:49151160-49151182 TGTCTAATGCTGAGAGTGGGGGG + Intronic
1111931150 13:94514411-94514433 TGACCATTGCAGAGTCTGAGAGG + Intergenic
1112651300 13:101401504-101401526 TCTCCACTGCTCAGTGAAAGAGG - Intronic
1113723492 13:112579494-112579516 CGCACACTGCTGAGTGTCAGGGG + Intronic
1114570023 14:23660436-23660458 TGTCCAATGGAGAGTTTGAGCGG + Intergenic
1115374998 14:32665131-32665153 TGTCCACTGCTTGGTGTATGGGG - Intronic
1115759142 14:36560361-36560383 TAGCCACTGCAGAGTGTAAGTGG + Intergenic
1115785972 14:36826532-36826554 AGTCCACTGCTGATTTTGAGTGG - Intronic
1116273497 14:42801824-42801846 TGTCCACTGATGTTTGGGAGAGG + Intergenic
1118040014 14:61906211-61906233 TGTCTACTGGTGAATGTGGGAGG + Intergenic
1120713831 14:87819321-87819343 TGTTTCCTGCTGAGAGTGAGGGG + Intergenic
1120945081 14:89987268-89987290 TGTCCCCTGCTTAGTGTATGAGG - Intronic
1121532190 14:94662783-94662805 TGTCCACAGATGGGAGTGAGTGG - Intergenic
1121767722 14:96502237-96502259 CACCCACTGCTAAGTGTGAGAGG + Intronic
1122591019 14:102851403-102851425 TGTCCACAGCTCAGTGTGAACGG + Intronic
1122713204 14:103676062-103676084 TCTCCAGCGCTGTGTGTGAGGGG - Intronic
1122903722 14:104792502-104792524 TGTGCCCTGCTGGGTGGGAGGGG - Intronic
1122919672 14:104874812-104874834 TGCCCACTGCTGGGTGGCAGTGG + Intronic
1124135834 15:27035691-27035713 TTGCCACAGCTGAGTGTGCGTGG + Intronic
1126006805 15:44265762-44265784 TCTCCATTGCTGAGAGAGAGAGG + Intergenic
1127533273 15:59865587-59865609 TGTCCACTGCTTGGTGTGTGAGG + Intergenic
1128065540 15:64762302-64762324 TCCCCACAGCTGAGTGTGAGTGG + Intronic
1128497396 15:68206262-68206284 TGTCCACAGCTGAGTCTATGAGG + Intronic
1129091221 15:73152775-73152797 TGTCCACTGCTAGGTGTGTGGGG + Intronic
1132988556 16:2780779-2780801 TGTCCAGTGCTTAGTGTGTGGGG + Intergenic
1135256799 16:20947612-20947634 TGTCCACTGCTTAATGTGTGGGG + Intronic
1135387077 16:22051890-22051912 TGTCCACTGCTTGGTGTGTGGGG + Intronic
1135678832 16:24439800-24439822 GGTCCACTGCTTGGTGTGTGGGG + Intergenic
1139355838 16:66366689-66366711 CGTCCAGGGCTGAGCGTGAGTGG - Exonic
1139517413 16:67459954-67459976 TGGCCACAGCACAGTGTGAGAGG + Intronic
1139874728 16:70136535-70136557 TGTCCCCTTCTAAGTATGAGAGG + Intronic
1140181861 16:72728590-72728612 TGTCCACAGAGGAGAGTGAGAGG - Intergenic
1140361056 16:74344608-74344630 TGTCCCCTTCTAAGTATGAGAGG - Intergenic
1140835366 16:78788901-78788923 TGTCCCCTGCTTAGTATGTGGGG + Intronic
1141360452 16:83390863-83390885 TGGCCTCTGCTCAGTGTCAGGGG - Intronic
1141591357 16:85071202-85071224 CATCCCCTGCTGTGTGTGAGAGG - Intronic
1141615049 16:85205692-85205714 TGTCCCCTCCTCAGTGTGAGTGG + Intergenic
1141829378 16:86501178-86501200 TGTCGACTGCAGAGGGTGACTGG + Intergenic
1141948965 16:87328481-87328503 TGTCCACTGCTGAGTGTGAGTGG - Exonic
1143787830 17:9269394-9269416 TGGCCACAGCTGAGTGTCAGAGG + Intronic
1144493510 17:15733394-15733416 TGTAAAATGCTGGGTGTGAGTGG - Intronic
1144717857 17:17446809-17446831 TTTCCAATGATCAGTGTGAGAGG - Intergenic
1144906752 17:18643258-18643280 TGTAAAATGCTGGGTGTGAGTGG + Intronic
1145941474 17:28745348-28745370 TGTACACTGCCGAGGGGGAGGGG - Intronic
1146320565 17:31843330-31843352 TGTGCACTCCTGAGTGTGGCAGG - Intergenic
1149401104 17:56296765-56296787 AGTCCACTGCTGAGTGTCATTGG + Intronic
1149936233 17:60810140-60810162 TGTCCAGTGGGGAGAGTGAGAGG - Intronic
1151343248 17:73485309-73485331 TGTCCAGTGCTGATCCTGAGGGG + Intronic
1152852051 17:82642704-82642726 TGTCCACTGCTTGGTGTGTGGGG + Intronic
1152911878 17:83009926-83009948 CGTCCACTGCTGTGGGGGAGGGG + Intronic
1153174519 18:2356025-2356047 TGTCCACTGTGAAATGTGAGTGG + Intergenic
1155398677 18:25415207-25415229 TGTCAACAGCTGAGTGTGGTGGG + Intergenic
1157293242 18:46424765-46424787 TGTCCAGGTCTGACTGTGAGGGG + Intronic
1158219082 18:55131242-55131264 ACTCCTCTGTTGAGTGTGAGAGG + Intergenic
1158384307 18:56971809-56971831 TGTCCCCTGATGTGTGTGAACGG + Intronic
1159257029 18:65960362-65960384 TGACCTCTACTGAGGGTGAGTGG + Intergenic
1160418653 18:78729026-78729048 CGTCCACTGCTGAGTGGGGGGGG + Intergenic
1160523484 18:79522205-79522227 TGTCCACTGATGTGTGTGTCTGG + Intronic
1161823416 19:6545539-6545561 TGTCCGCTGCTAGGTGTGTGGGG - Intergenic
1164039702 19:21483733-21483755 TCCCCGCTGCTGAGTGGGAGAGG - Intronic
1164546985 19:29174074-29174096 TGGCCAGTGCTGAGTGAGACTGG - Intergenic
1164717968 19:30407414-30407436 TGTCCACTGCTGGGTGTGTGGGG - Intronic
1168225256 19:54990036-54990058 AGCCCACTGCTGAGTGGTAGCGG - Exonic
925215914 2:2095792-2095814 AGTAAAGTGCTGAGTGTGAGCGG - Intronic
926478893 2:13363351-13363373 TGTCCAATGCTGAATGTGCAGGG - Intergenic
926887926 2:17614568-17614590 TGGCCACAGCTGAGTGAGTGAGG - Intronic
927898188 2:26798830-26798852 TGTCCACTGCTTGGTGTATGGGG + Intronic
928360200 2:30656363-30656385 AGTTCATTCCTGAGTGTGAGTGG + Intergenic
929452285 2:42046160-42046182 GGACCAAGGCTGAGTGTGAGGGG + Intergenic
932596606 2:73097508-73097530 TGTCCACTGTTAAGTGTTGGGGG - Intronic
933997873 2:87683161-87683183 TGTCCACTGCTTGGTGTGTGGGG + Intergenic
936295977 2:111267705-111267727 TGTCCACTGCTTGGTGTGTGGGG - Intergenic
936970276 2:118170095-118170117 TGTCATCTGCTAAGAGTGAGAGG - Intergenic
937032093 2:118749419-118749441 TGTCCACTGTTGAATGTGTAGGG + Intergenic
937241243 2:120463850-120463872 TGTCCCCCACTGAGTGTGCGTGG - Intergenic
937659790 2:124417612-124417634 TTACCATTGCTGAGTGTGAGTGG + Intronic
937845944 2:126578996-126579018 TGTACACTGCTGAGGGAGGGAGG - Intergenic
938261453 2:129898373-129898395 TGTCCATTACTGAGAGTGGGAGG - Intergenic
940377124 2:152969327-152969349 TGTTCCCCTCTGAGTGTGAGGGG + Intergenic
941091518 2:161182216-161182238 TGTCCACTGCTTAATATGTGGGG - Intronic
942141157 2:172978544-172978566 TGTCCACTACTGAGTGTGACAGG + Intronic
942222546 2:173784495-173784517 TCTGCATTTCTGAGTGTGAGGGG + Intergenic
944827111 2:203495634-203495656 TGTCCTCTGCTGATTGAAAGGGG - Intronic
944841335 2:203626725-203626747 TGGCCACTGCTTAATCTGAGAGG + Intergenic
948879371 2:240848659-240848681 AGACCACTGCTGTGTGTTAGAGG + Intergenic
1169210983 20:3766249-3766271 TGTCCAGTCCTGAGAGTCAGCGG - Intronic
1170823062 20:19770786-19770808 TGTCCACTACTTGGTGTGTGGGG - Intergenic
1171422000 20:25023834-25023856 TGTCCAGTTCTGAGGCTGAGGGG + Intronic
1173770105 20:45648870-45648892 TGTCCACTTCTGAGTAGGTGAGG + Intronic
1175899430 20:62354228-62354250 TGTCCGCAGCTGAGGGTTAGGGG - Intronic
1176237525 20:64060648-64060670 TGTCCCCAGCTCACTGTGAGGGG + Intronic
1179503425 21:41824013-41824035 TGTCCACTGCTCTGTGCCAGTGG - Intronic
1180950846 22:19719878-19719900 TGCTCAGTGCTGAGGGTGAGTGG + Exonic
1181039506 22:20185113-20185135 TGACCACTGCTCAGCCTGAGTGG - Intergenic
1181895775 22:26106188-26106210 TGTCCACTGCTGGGGGCTAGAGG + Intergenic
1182103588 22:27673788-27673810 TGTCCATTCTTGAGTGTGAGAGG + Intergenic
1182521886 22:30889448-30889470 TGGCCTCTGCTGACGGTGAGGGG + Intronic
1183467422 22:37986728-37986750 TGACCAGTGCTGTGTGTGTGTGG + Intronic
1183474312 22:38027417-38027439 TGTCCTCTGCTCAGTGGGGGTGG + Intronic
1184739587 22:46419706-46419728 TGTACACACGTGAGTGTGAGTGG - Intronic
953797562 3:45997135-45997157 GGTCCACTGCTCAGTGTGTGGGG - Intergenic
956010753 3:64829099-64829121 TGGCCAAAGCTCAGTGTGAGAGG - Intergenic
956638557 3:71391676-71391698 TGCCCAATGCTGAGAGTTAGTGG - Intronic
957880941 3:86212325-86212347 TGTCAACTGCTGAATCTGCGAGG - Intergenic
958454249 3:94309543-94309565 TGTCCATTGCTTAGTGTGTGGGG + Intergenic
960374791 3:116886337-116886359 TGACCACTGCTTAGTGTCAGTGG + Intronic
961451878 3:127005878-127005900 TGCCTCCTGCTCAGTGTGAGGGG - Intronic
961488479 3:127234057-127234079 TGTTCAGTGTTGTGTGTGAGGGG + Intergenic
961682931 3:128611038-128611060 GGTCCACAGCTGGGTGTGGGGGG - Intergenic
961693713 3:128689204-128689226 TGTCCACTGCTTGATGTGTGGGG + Intergenic
962329974 3:134469426-134469448 TGCTCACTGCTGAGTATTAGAGG + Intergenic
962873566 3:139518831-139518853 TGAGCACAGCTGGGTGTGAGGGG + Intronic
963069349 3:141290170-141290192 TGGCAGCTGCTGAGTGTGAGAGG + Intronic
963192189 3:142484802-142484824 TGTCCACTGCTTGGTGTATGGGG + Intronic
963361209 3:144274243-144274265 TGTCCACTGTTGAGTTTTAGTGG + Intergenic
963669721 3:148236292-148236314 TGACCACTGCTGTATGTTAGAGG - Intergenic
963994033 3:151685596-151685618 TGTCCACTGCTTGGTGTGTGGGG + Intergenic
964002337 3:151789999-151790021 TGTGCACAGCTCATTGTGAGTGG - Intergenic
964109278 3:153072557-153072579 TGTCCACTGCTTGGTGTGTGGGG - Intergenic
964741958 3:159975557-159975579 TGTTCTGTGTTGAGTGTGAGAGG + Intergenic
966345383 3:178973510-178973532 TCCCCACTGGTGAATGTGAGAGG + Intergenic
967163462 3:186759627-186759649 TGTCCTCTGCTTGGTGTGTGAGG - Intergenic
969388776 4:6875118-6875140 TGTCCTCTGCTGAGGCTGGGAGG - Intronic
969598854 4:8163868-8163890 TTTCCATTGCTGAGTGAGAGTGG - Intergenic
969665720 4:8556341-8556363 TGTCCACATCTGAGTGTGCACGG - Intergenic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
973670450 4:53211660-53211682 TGTCCGCTGCTTTGTGTGTGGGG + Intronic
974150307 4:57998658-57998680 TGACAACTGCTGATTGAGAGGGG - Intergenic
975443644 4:74439058-74439080 TGTTCACCTCTGAGTGTGAGGGG + Intergenic
976516296 4:85970992-85971014 TATCCTCTTCTGAGTGTGAGTGG - Intronic
977348691 4:95851986-95852008 TGTTCAGTGCTGAGTGTAATAGG - Intergenic
980765725 4:137301425-137301447 TGTCCACCGCTTGGTGTGTGGGG - Intergenic
986974532 5:13379876-13379898 TGCCCACTGCTTGGTGTGTGGGG + Intergenic
989532232 5:42521296-42521318 TGCCCATTGCTGTGTATGAGGGG - Intronic
990232451 5:53728023-53728045 TGTCCACTGCTTGGTGTGTGGGG + Intergenic
990845244 5:60130269-60130291 TGTGCACTGCTGATTGAGATGGG + Intronic
990866661 5:60387775-60387797 TGTCCACTGCTTGATGTGTGGGG - Intronic
990878645 5:60516906-60516928 CACCCACTTCTGAGTGTGAGGGG + Intronic
993189887 5:84668643-84668665 TGTCTGCTGCTTAGTGTGTGGGG + Intergenic
993857760 5:93097259-93097281 TGTCCAATGCTTGGTGTGTGGGG - Intergenic
995709291 5:115018458-115018480 TGACCAGTGCTGAGTGGGAAGGG - Intergenic
995795489 5:115936835-115936857 TGTCCACTGCTTGGTGTGTGAGG + Intergenic
997409319 5:133679099-133679121 TGTCCTCTCCTGAGAGGGAGAGG - Intergenic
998536447 5:142935963-142935985 AGTCCTCTGCTGAGTAAGAGTGG - Intronic
998744445 5:145241804-145241826 TGTTCACTGGTCAGTGTAAGAGG - Intergenic
1000179150 5:158790981-158791003 TGTCCCCTTCTGACTGTGGGAGG + Intronic
1000543145 5:162566053-162566075 TTTTTACTGCTGAGTGGGAGTGG + Intergenic
1000772130 5:165367971-165367993 TGTCCACTGCTCAGAGTGTGGGG - Intergenic
1000911598 5:167029700-167029722 TGTCCAGTGCTGTGTGCCAGGGG + Intergenic
1001678352 5:173536927-173536949 GGTCCCCTGTGGAGTGTGAGAGG - Intergenic
1002185706 5:177453970-177453992 TCTCCACAGCTGCGGGTGAGAGG - Exonic
1004576524 6:16901062-16901084 TGTCCCCAGCAGACTGTGAGTGG + Intergenic
1004580288 6:16944382-16944404 TGGCCACAGCTGAATGAGAGAGG - Intergenic
1005500336 6:26423594-26423616 TGTGCACTTCTGAGAGTGAGAGG + Intergenic
1005879556 6:30045463-30045485 TGTCCACTGCTTGGTGTGTGGGG - Intergenic
1006426543 6:33966857-33966879 TGTTCATTGCAGAGTGAGAGAGG - Intergenic
1007187018 6:39980545-39980567 TGACAACTGCTGATAGTGAGGGG + Intergenic
1007300034 6:40860858-40860880 TGCCCACTGCTGGGTGTCTGTGG + Intergenic
1007884408 6:45209879-45209901 TGACAGCTGCTGAGTTTGAGTGG - Intronic
1008138275 6:47802064-47802086 TGTGCCCTGCTTAGAGTGAGAGG + Intronic
1008362775 6:50641441-50641463 TGTCCACTGCTGTAGGTGGGTGG - Intergenic
1009770862 6:68141415-68141437 TGTCCAGTGCTGAAAGTGGGAGG + Intergenic
1010534464 6:77011041-77011063 TGCCCACTGCTGAGTTAAAGTGG + Intergenic
1011001910 6:82599914-82599936 TGTCCACTGACAAGTGTGTGAGG + Intergenic
1012999539 6:106008657-106008679 AGACCCCTTCTGAGTGTGAGAGG + Intergenic
1015593426 6:134843763-134843785 TGTCCACTGCTTGGTGTGTGAGG + Intergenic
1017067600 6:150543561-150543583 TAGAGACTGCTGAGTGTGAGAGG - Intergenic
1017752721 6:157503312-157503334 TTCCCACTGCTGCTTGTGAGAGG + Intronic
1021296245 7:18910026-18910048 TGTCCAATGCTGAGAGAGTGGGG + Intronic
1022280415 7:28903062-28903084 TTCCCACTGCTCAGTGTGTGAGG + Intergenic
1022316966 7:29254636-29254658 TAACCAATGCTGGGTGTGAGTGG - Intronic
1022345217 7:29508235-29508257 GGCCCACTGCTGAGGGAGAGAGG + Intronic
1022711341 7:32853871-32853893 TCTCTACTGCTGATTGAGAGGGG - Intergenic
1022913318 7:34921090-34921112 TCTCTACTGCTGATTGAGAGGGG + Intergenic
1025165221 7:56706319-56706341 CGTACACTGTTGAGTGTAAGGGG + Intergenic
1025607617 7:63050740-63050762 TGTGTACAGATGAGTGTGAGGGG - Intergenic
1029108208 7:98195404-98195426 TGTGCACTGCTGAGTGGGCATGG + Intronic
1030762578 7:113369780-113369802 CTTCCACTGCTGGGTGAGAGAGG + Intergenic
1031564033 7:123272337-123272359 TGTGCACTTGTGTGTGTGAGTGG - Intergenic
1032270303 7:130398916-130398938 TGACCACTGCTGAGGGAGCGGGG + Exonic
1033237618 7:139650614-139650636 TTTGCCCTGCTCAGTGTGAGAGG - Intronic
1033660591 7:143399328-143399350 AGAGCACTGCTGAGTCTGAGGGG - Exonic
1035903778 8:3487012-3487034 TGTCACCTTCTGTGTGTGAGAGG - Intronic
1038271690 8:26080899-26080921 TGTCCACTGCTGAGCCTGTTGGG + Intergenic
1038865252 8:31432622-31432644 TGTCCACTACTGCCTGTGACTGG + Intergenic
1038970137 8:32624304-32624326 TATCCACTGCTGTGTGTGTTGGG + Intronic
1039699858 8:39951113-39951135 TGTCTACTTCTGAGTGTTACCGG - Intronic
1039804451 8:40986591-40986613 TGTCCACTGCTTGGTGTGTGTGG - Intergenic
1041862967 8:62535332-62535354 TGTTCACTGCTTGGTGTGTGGGG - Intronic
1044020839 8:87103892-87103914 GGTCCTCTGCTGAGAGTAAGAGG + Intronic
1044541772 8:93416447-93416469 TGTCTCCTGCTGAGAGAGAGAGG - Intergenic
1045207712 8:100059704-100059726 TGTCCAATGCTGAAAGTCAGAGG - Intronic
1046425247 8:114039196-114039218 TGTCCAATGCTGAGAGTGATGGG - Intergenic
1047093407 8:121597557-121597579 TGTCCGCTGCTTGGTGTGTGTGG + Intergenic
1048624331 8:136168054-136168076 AGGCCACTGCTGTGTGTGACAGG - Intergenic
1048631425 8:136247136-136247158 TCTCCCCAGCTGAGTGTGAGGGG + Intergenic
1049012191 8:139894501-139894523 CATCCCCTGCGGAGTGTGAGGGG + Intronic
1050459028 9:5861541-5861563 TGTCCACTTCTTAGTGAGAAAGG - Intergenic
1051699917 9:19810981-19811003 TGTTCACTGCGGAGTGAAAGAGG - Intergenic
1052457529 9:28719456-28719478 TGTACACTGATGAGTTTGGGAGG - Intergenic
1053181097 9:35971359-35971381 CGTCCACTCCTGAGGCTGAGCGG - Intergenic
1053833358 9:42108111-42108133 TGTACACTACTGAGTCAGAGGGG + Intronic
1054597192 9:67079300-67079322 TGTACACTACTGAGTCAGAGGGG - Intergenic
1055673485 9:78631264-78631286 GGGCGACTGCTGAGTGGGAGGGG + Intergenic
1057458049 9:95232278-95232300 TCTCCAATGTTGAGGGTGAGTGG - Intronic
1061281679 9:129601322-129601344 GGCCTACTGCAGAGTGTGAGGGG + Intergenic
1185910654 X:3977524-3977546 TGTCCACTGCTTGGTGTTTGGGG + Intergenic
1186995577 X:15117890-15117912 TGGTCACTGCTGACTGTTAGAGG - Intergenic
1190732281 X:53234047-53234069 TGGCAACTGCTGGGGGTGAGAGG + Exonic
1192402414 X:70849292-70849314 TGTTCAGTGCTATGTGTGAGTGG - Intronic
1192945559 X:75963041-75963063 TGTCCAATGGTGGATGTGAGAGG + Intergenic
1195760658 X:108242803-108242825 GGTGCACTGGTGAGTTTGAGAGG - Intronic
1198785203 X:140280505-140280527 TGTCCAATGCTGAAAGTGAGGGG + Intergenic
1201148854 Y:11083566-11083588 TGTCCTCTGCTGAGCATGAGTGG + Intergenic
1202594643 Y:26523832-26523854 TGTCCAATGCTGAGATTGAGTGG - Intergenic