ID: 1141949463

View in Genome Browser
Species Human (GRCh38)
Location 16:87331317-87331339
Sequence GCATCTCATCGAAGGCCTGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 80}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141949460_1141949463 10 Left 1141949460 16:87331284-87331306 CCGGTCAGGAGGTGAGGGACTGA 0: 1
1: 0
2: 10
3: 75
4: 547
Right 1141949463 16:87331317-87331339 GCATCTCATCGAAGGCCTGTGGG 0: 1
1: 0
2: 0
3: 4
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141949463 Original CRISPR GCATCTCATCGAAGGCCTGT GGG Exonic