ID: 1141952696

View in Genome Browser
Species Human (GRCh38)
Location 16:87348854-87348876
Sequence CAGTTGTTCTGCGGGATCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 118}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141952696_1141952702 3 Left 1141952696 16:87348854-87348876 CCCTGGATCCCGCAGAACAACTG 0: 1
1: 0
2: 1
3: 7
4: 118
Right 1141952702 16:87348880-87348902 ACTCAGCAAGGCAGGTAATGAGG 0: 1
1: 0
2: 0
3: 16
4: 237
1141952696_1141952700 -9 Left 1141952696 16:87348854-87348876 CCCTGGATCCCGCAGAACAACTG 0: 1
1: 0
2: 1
3: 7
4: 118
Right 1141952700 16:87348868-87348890 GAACAACTGAGCACTCAGCAAGG 0: 1
1: 0
2: 1
3: 30
4: 168
1141952696_1141952704 14 Left 1141952696 16:87348854-87348876 CCCTGGATCCCGCAGAACAACTG 0: 1
1: 0
2: 1
3: 7
4: 118
Right 1141952704 16:87348891-87348913 CAGGTAATGAGGGAGTACACCGG 0: 1
1: 0
2: 1
3: 10
4: 146
1141952696_1141952701 -5 Left 1141952696 16:87348854-87348876 CCCTGGATCCCGCAGAACAACTG 0: 1
1: 0
2: 1
3: 7
4: 118
Right 1141952701 16:87348872-87348894 AACTGAGCACTCAGCAAGGCAGG 0: 1
1: 0
2: 1
3: 13
4: 201
1141952696_1141952703 4 Left 1141952696 16:87348854-87348876 CCCTGGATCCCGCAGAACAACTG 0: 1
1: 0
2: 1
3: 7
4: 118
Right 1141952703 16:87348881-87348903 CTCAGCAAGGCAGGTAATGAGGG 0: 1
1: 0
2: 0
3: 22
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141952696 Original CRISPR CAGTTGTTCTGCGGGATCCA GGG (reversed) Intronic
902720029 1:18297873-18297895 CAGTTGGCCTTCCGGATCCATGG - Intronic
905741829 1:40377838-40377860 CAGTTGTCCTTTGGTATCCAGGG + Intronic
913304345 1:117409908-117409930 CAGTTGTCCTTTGGTATCCATGG + Intronic
914345278 1:146793792-146793814 CTGCTGTTCTGCAGGATCAAGGG - Intergenic
914491149 1:148151488-148151510 CAGGTGTTCTGTGGCATCCCAGG - Intronic
919001598 1:191838748-191838770 CAGTTGTTCCTCAGTATCCATGG - Intergenic
921115327 1:212084848-212084870 CAGTTGTCCCTCAGGATCCATGG + Intronic
921142141 1:212318947-212318969 CAGTTGATCTGCATTATCCATGG - Intronic
923084948 1:230696100-230696122 GAGATGTTCTGGGGGAACCATGG - Intergenic
924612191 1:245582932-245582954 GAGTTGTTTTGCGGGGTGCAGGG - Intronic
1066303742 10:34119162-34119184 CCGTGGTTGTGTGGGATCCATGG - Intronic
1067729872 10:48802932-48802954 CATTTGTCTTGCAGGATCCAGGG + Intronic
1068561762 10:58522876-58522898 CTGTAGTTCTGTGGGATCGATGG - Intronic
1071059109 10:81548687-81548709 TGGTTGTTCTGAGGAATCCAGGG + Intergenic
1071232312 10:83602701-83602723 CAGTAGTCCTGAGGCATCCATGG + Intergenic
1072630090 10:97139823-97139845 CAGCTGTTCAGCTGGAGCCAAGG - Intronic
1074915236 10:117949152-117949174 CAGTTGTTCCTCAGTATCCATGG + Intergenic
1077256219 11:1584667-1584689 CGGTTCTTGTGGGGGATCCAAGG - Exonic
1077268923 11:1666078-1666100 CCGTTGTTCTGGGGGGTCAAAGG + Intergenic
1077886869 11:6393317-6393339 GAGCTGTCCTGCGGGATCCGTGG - Exonic
1077901531 11:6493876-6493898 CAGTTGTTCTGCCTTCTCCAAGG - Intronic
1080635172 11:34117408-34117430 CAGTTGTTCAGCAGCATCCCTGG - Intronic
1087215877 11:95493664-95493686 CAGTTGTTATTTGGTATCCATGG + Intergenic
1087310347 11:96534328-96534350 CAGTTGTTCTGCTGGTTGCTGGG + Intergenic
1087997290 11:104825219-104825241 CAGTTATTCTTTGGTATCCATGG - Intergenic
1088396203 11:109372403-109372425 CAGTTGTTCCTTGGTATCCATGG - Intergenic
1091098363 11:132845554-132845576 CAGATGTTCTCTGGGATCCCAGG + Intronic
1092655914 12:10685424-10685446 CAGTTGTTCCTTGGTATCCATGG - Intergenic
1095039089 12:37422462-37422484 CAGTTGTTCCACGGTTTCCAAGG - Intergenic
1095365855 12:41404228-41404250 CAGTTGGTCTTCCGAATCCATGG - Intronic
1096444137 12:51673382-51673404 CAGTTGTTCCTCAGTATCCACGG - Intronic
1098160342 12:67643463-67643485 CATTTGTCCTGCTGGATCAAAGG + Intergenic
1098593805 12:72247023-72247045 CAGTTATTCTTCAGTATCCATGG + Intronic
1098959256 12:76721515-76721537 CAGTTTTCCTGCTGGAACCATGG + Intergenic
1099364864 12:81756323-81756345 AAGTTGTTCTGAGTGATTCAGGG - Intronic
1102052635 12:109874026-109874048 CAGTGGTTCTGCTGGCACCATGG - Intronic
1104921471 12:132292824-132292846 CCGTTGTTCGGTGGAATCCATGG + Intronic
1108323990 13:49312327-49312349 CAGTTGCTCTGGGGGAGTCAGGG - Intronic
1113659185 13:112093299-112093321 CATTGGTTCTTCTGGATCCAGGG + Intergenic
1113825381 13:113248604-113248626 CAGTTGTTCCTCAGTATCCACGG + Intronic
1116196030 14:41726246-41726268 TTGTTGTTCAGAGGGATCCAGGG + Intronic
1117761300 14:59031571-59031593 AAGTTGTTCTGGGTGATGCAGGG + Intergenic
1118302817 14:64630436-64630458 CAGTTGTTCTTCGGTACCCATGG - Intergenic
1118901749 14:69992087-69992109 CAGTTTTCCTGCGGGAACAAGGG + Intronic
1202889868 14_KI270722v1_random:145972-145994 CAGTTGTTCCTCAGTATCCATGG - Intergenic
1127179728 15:56402309-56402331 CTGTATTTCTGCGGGATCCGTGG - Intronic
1129583933 15:76842652-76842674 CAGTTGTTCCTCAGTATCCATGG - Intronic
1135891087 16:26358197-26358219 CTGTTGTGCTGTGGGCTCCAAGG + Intergenic
1139988714 16:70921500-70921522 CTGCTGTTCTGCAGGATCAAGGG + Intronic
1141952696 16:87348854-87348876 CAGTTGTTCTGCGGGATCCAGGG - Intronic
1144101046 17:11942586-11942608 CAGTTGTCCTGCAGCATCCTAGG + Intronic
1147886561 17:43688234-43688256 CAGTGCTTCTGCAGGCTCCAGGG + Intergenic
1152762940 17:82119030-82119052 TAGTTGTTCTCCAGGAGCCAAGG - Intronic
1154365146 18:13701185-13701207 CAGCTGCTCTGAGGGATCAAAGG - Intronic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1160147831 18:76379050-76379072 CACCTGTGCTGCGGGGTCCAGGG - Exonic
1161471052 19:4457043-4457065 GAGTTGTTTTGAGGTATCCATGG - Intronic
1162760422 19:12885559-12885581 CAGCTCTTCCGCGGGCTCCAGGG - Exonic
1163690367 19:18735368-18735390 CCTTTGTTCTGCTTGATCCAGGG + Intronic
1202665278 1_KI270708v1_random:112794-112816 CAGTTGTTCCTCAGTATCCATGG - Intergenic
926001155 2:9333806-9333828 AAGTTTTTCTGCTGGAGCCATGG - Intronic
938273222 2:129993429-129993451 TTGTTGTCGTGCGGGATCCATGG - Intergenic
938442996 2:131352667-131352689 GCCTTGTTGTGCGGGATCCATGG + Intronic
947618424 2:231573677-231573699 CAGTTGTTCTGCAGGAGTGAGGG - Intergenic
1177162595 21:17564131-17564153 TAGTTATTCTTCGGTATCCATGG + Intronic
1177525493 21:22285692-22285714 CAGTTGTCCTTTGGTATCCATGG + Intergenic
1177986481 21:27981356-27981378 CAGTTCCTATGGGGGATCCACGG + Intergenic
1180331992 22:11489714-11489736 CAGTTGTTCCTCAGTATCCATGG - Intergenic
1183060922 22:35335941-35335963 CAGCTGCTGTGCGGGAGCCAGGG - Intronic
949283493 3:2374031-2374053 CTTTTGTTCTCCGGGATACATGG + Intronic
949351015 3:3125368-3125390 CAGTTGTCCTTCCGTATCCATGG - Intronic
950142556 3:10625439-10625461 CAGTAGTTCAGCGGGAGCCAGGG - Intronic
953686967 3:45085635-45085657 AAGTTATTCTGCTGGCTCCATGG + Exonic
953710784 3:45268607-45268629 CAGTTGTTCCTTGGTATCCATGG + Intergenic
955476446 3:59341124-59341146 CAGTTGTCCTTCAGTATCCATGG - Intergenic
963513672 3:146280620-146280642 CAGTTGTTCCTTGGAATCCATGG + Intergenic
969831445 4:9800885-9800907 CAGTTGTCCCTCGGTATCCATGG - Intronic
971332826 4:25696436-25696458 CAGGTGATCTGCAGGCTCCAGGG - Intergenic
973198112 4:47468456-47468478 TATTTGTTCTGTGTGATCCATGG + Intergenic
973304208 4:48625720-48625742 CAGTTGTCCTTTGGTATCCATGG - Intronic
981910022 4:149968101-149968123 CAGTTTTTCTGGAGGATCAAGGG - Intergenic
982096873 4:151931337-151931359 CAGTAGTTCTGGGGCAGCCATGG + Intergenic
985347200 4:189018613-189018635 CAGTTGTTCTTCAGTCTCCATGG - Intergenic
988151342 5:27385839-27385861 CAGTCATTCTTCGGTATCCATGG + Intergenic
990441769 5:55853521-55853543 CAGATGTTCTGCTGGCTCAAAGG - Intronic
990601278 5:57360866-57360888 CACTTGAACTGCTGGATCCAGGG + Intergenic
991730163 5:69578137-69578159 CAGTCGTTCTTCGGTATCCTTGG - Intronic
991806597 5:70433295-70433317 CAGTCGTTCTTCGGTATCCTTGG - Intergenic
991864790 5:71049711-71049733 CAGTCGTTCTTCGGTATCCTTGG + Intronic
996847748 5:127919468-127919490 CCATGGTTCTGCAGGATCCATGG + Intergenic
997952327 5:138252476-138252498 CAGATGTTCGGCAGGATCCGGGG + Exonic
998527582 5:142856872-142856894 CAGTTGTCCCTCGGGATCCATGG - Intronic
1000915825 5:167080032-167080054 CATTTGTCCTGCATGATCCAAGG + Intergenic
1001639062 5:173232606-173232628 GAGTTGCTCTGCGGAATCCCGGG + Exonic
1005175102 6:23035774-23035796 CAGGTGTCCTGCAGGATCCAAGG + Intergenic
1007213555 6:40217971-40217993 AAGGTGTTCTGGGTGATCCAAGG - Intergenic
1007519095 6:42437834-42437856 CAGTTGTTCTGAGGGTTAAAGGG + Intronic
1007585658 6:42987672-42987694 CACCTGTTCTGCAGGAGCCAGGG + Intronic
1008259650 6:49349516-49349538 CAGTTGGCCTGCTGTATCCATGG + Intergenic
1009820823 6:68798853-68798875 CAGCTTTTCTGGGAGATCCACGG - Intronic
1013141658 6:107342149-107342171 CAGTTGCTCTGCTGGGTGCAGGG - Intronic
1013680508 6:112520547-112520569 CAGTTGCTCTGAGGGAGCAATGG + Intergenic
1013883536 6:114933942-114933964 CAGGTGTGCTGGGGGACCCAAGG + Intergenic
1019198469 6:170296006-170296028 CAGATGATCCGCGGGTTCCAGGG - Intronic
1025285151 7:57654533-57654555 CAGTTGTTCCACGGTTTCCACGG - Intergenic
1030875816 7:114811914-114811936 CAGTTGTCCTCCGGTACCCATGG - Intergenic
1034691463 7:153017641-153017663 CAGTTGTTCTGCGGGCTCCCAGG - Intergenic
1039583833 8:38688659-38688681 CTGTTGTTCCTCGGGATCCATGG - Intergenic
1042175790 8:66036028-66036050 GAGTTGTTCAGCGTGATGCAGGG + Intronic
1043364203 8:79513021-79513043 CAGGGGTTCTACGGCATCCAGGG - Intergenic
1048450689 8:134530984-134531006 CAGTTGTTCCTAGGCATCCATGG - Intronic
1048751205 8:137678469-137678491 CAGTTGTTCCTTGGTATCCATGG - Intergenic
1050647246 9:7733346-7733368 CAGTTGTCCCTCGGTATCCATGG + Intergenic
1053577943 9:39371868-39371890 CAATTGTGCTGTGGGATCCCAGG + Intergenic
1053842469 9:42199927-42199949 CAATTGTGCTGTGGGATCCCAGG + Intergenic
1054099527 9:60930653-60930675 CAATTGTGCTGTGGGATCCCAGG + Intergenic
1054120924 9:61206277-61206299 CAATTGTGCTGTGGGATCCCAGG + Intergenic
1054586814 9:66976230-66976252 CAATTGTGCTGTGGGATCCCAGG - Intergenic
1058765148 9:108175318-108175340 CAGTTGTTCTTTGGTAACCACGG - Intergenic
1203486970 Un_GL000224v1:65202-65224 CAGTTGTTCCTCAGTATCCATGG - Intergenic
1203499591 Un_KI270741v1:7102-7124 CAGTTGTTCCTCAGTATCCATGG - Intergenic
1188076791 X:25786693-25786715 CAGTTGTCCTTCGGTATCCATGG - Intergenic
1189454592 X:41174362-41174384 CAGTTATTCCCCGGTATCCATGG - Intronic
1194403615 X:93467818-93467840 CAGGGGTTCTCAGGGATCCAAGG - Intergenic
1199667741 X:150114165-150114187 CAGGTACTCTGCGGGTTCCATGG + Intergenic
1200039163 X:153353459-153353481 CAGTTGGGCTGCTGGCTCCACGG - Intronic
1200129592 X:153833779-153833801 CAGTTGTCCTTCGGTGTCCACGG + Intergenic