ID: 1141953230

View in Genome Browser
Species Human (GRCh38)
Location 16:87352875-87352897
Sequence AACCCAGATGTGCCGGCGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 82}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141953230_1141953236 18 Left 1141953230 16:87352875-87352897 CCAGGCGCCGGCACATCTGGGTT 0: 1
1: 0
2: 0
3: 9
4: 82
Right 1141953236 16:87352916-87352938 GACTCAGAGTCCCTGAACCTTGG 0: 1
1: 0
2: 0
3: 24
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141953230 Original CRISPR AACCCAGATGTGCCGGCGCC TGG (reversed) Intronic
900162608 1:1231659-1231681 AGACCAGACGTGCCGGCGGCCGG + Intronic
900637927 1:3674911-3674933 AACCCAGAAGAGCCCCCGCCTGG - Intronic
902465106 1:16612861-16612883 AAGCCAGGTGTGCCAGCTCCAGG - Intronic
902714558 1:18263441-18263463 AACTCAGATGTGCATTCGCCTGG - Intronic
905583109 1:39097196-39097218 CACCCAGATGTTCAGGCTCCAGG + Intronic
907307712 1:53522555-53522577 ACCCCAGAAGTGCCAGAGCCAGG - Intronic
913226893 1:116708379-116708401 AGCCCAGATGTGCCCACTCCTGG - Intergenic
913482447 1:119301703-119301725 AACAGAGATGTGCTGGGGCCTGG + Intergenic
915328223 1:155092243-155092265 AGCCCAGATGTGCTGGGGCCAGG + Intergenic
920085050 1:203409222-203409244 AACCCAGCTGTGCCTCTGCCTGG - Intergenic
924512098 1:244736168-244736190 AAGCCAGCTGTGCCGGAGACTGG + Intergenic
1063662870 10:8046011-8046033 AACCCAGATGTGTCTGCATCTGG + Intergenic
1067835250 10:49634313-49634335 AAAGCAGATGGGCTGGCGCCTGG + Intronic
1075292396 10:121241634-121241656 AAGTCAGATGTGCCGGGACCAGG + Intergenic
1077152205 11:1077432-1077454 GACCCCGATGTGCCTCCGCCAGG + Intergenic
1077209019 11:1359766-1359788 AACCCAGACGTGCTGACGCGGGG + Intergenic
1080872962 11:36252886-36252908 AACCCATATGTGCAGCCTCCTGG - Intergenic
1088847269 11:113679309-113679331 AACCCAGACTTGCCAGCTCCTGG + Intergenic
1092597003 12:10018142-10018164 AACCCAGATGTGCCAGCTCTGGG + Intronic
1103562539 12:121800127-121800149 AATGCAGATGAGCCGCCGCCCGG - Intronic
1117329079 14:54694840-54694862 CACCCAGCTGTGCCGGTACCTGG + Intronic
1118744081 14:68761580-68761602 AAACCAGATGTGCCTGCCACAGG + Intergenic
1120874949 14:89367356-89367378 CACCCTGATGTGGCGGCACCCGG + Intronic
1123040058 14:105486801-105486823 ACCCCAGATCTGCCCGGGCCAGG - Intergenic
1123853128 15:24380753-24380775 ATCCCAAATGTGCCCGAGCCAGG - Intergenic
1129868749 15:78927868-78927890 AAACAAGATGTGCCAGGGCCTGG + Intronic
1132718367 16:1303573-1303595 AGCCCAGGTGTGCAGGAGCCAGG + Intergenic
1135854047 16:25990465-25990487 AACCCAGATGTTTCGGCTCAGGG + Intronic
1138925022 16:61580814-61580836 CACACAGTTGTGCTGGCGCCTGG - Intergenic
1139915888 16:70428258-70428280 AACCCAGCTGGGCCGAAGCCAGG + Intronic
1140113707 16:72024030-72024052 AAACCAGATGTGCCTGGGCCGGG + Intronic
1141506710 16:84482831-84482853 AACCCTGATCTGCCGACACCTGG - Intronic
1141953230 16:87352875-87352897 AACCCAGATGTGCCGGCGCCTGG - Intronic
1142705308 17:1690048-1690070 ATCCCAGATGTGATGGCGGCCGG + Intergenic
1146439200 17:32878516-32878538 AACCCAGCTCTGCTGGTGCCAGG - Intergenic
1146616577 17:34361656-34361678 AACCCAGAGCTGCCAGCACCTGG - Intronic
1147331046 17:39699852-39699874 AACCCAGGCGTCCCGGCGCTAGG + Intronic
1148969921 17:51470763-51470785 AACCCAGATCTCCCAGAGCCAGG - Intergenic
1151219612 17:72602865-72602887 CACCCAGAAGTGCCAGCACCAGG + Intergenic
1160391736 18:78539240-78539262 GACCCTGGGGTGCCGGCGCCCGG + Intergenic
1160691280 19:461562-461584 AACCCAGGAGTGCCGGCTCGGGG + Intergenic
1163416284 19:17188504-17188526 AAGCCAGAGGTGACAGCGCCTGG + Intronic
1163897720 19:20074192-20074214 AAACCAGCTGTGCTGGTGCCTGG - Intergenic
1164840742 19:31390398-31390420 TAACCAGAGCTGCCGGCGCCAGG - Intergenic
1165092492 19:33394382-33394404 CGCCCAGATGTGCCGGCCCGGGG + Intronic
1165417659 19:35704667-35704689 ACCCCAGATTTGCCTGGGCCGGG - Intronic
933690546 2:85176224-85176246 AACTCAGATGTCCCAGGGCCTGG - Intronic
934874515 2:97903951-97903973 AACCCAGATGGGCCTGGGCACGG - Intronic
934941921 2:98508990-98509012 AACCCAGGGGTGCCGCTGCCTGG + Intronic
941792515 2:169568285-169568307 AACCTAGAAGTGCAGGAGCCAGG - Intronic
1171972510 20:31573126-31573148 AACCCAGGTGTGGCCGCGGCGGG - Intronic
1173874870 20:46364150-46364172 ATACCAGATGAGCCGGCGTCCGG + Intronic
1176102983 20:63372906-63372928 CAGCCAGATGTGCTGGGGCCAGG - Intronic
1178627180 21:34227902-34227924 AACCCAGATGGGACTGGGCCTGG + Intergenic
1178942003 21:36914182-36914204 CAGCCAGATGTGCTGGCCCCTGG - Intronic
1179482539 21:41687407-41687429 AACCCAGGTGTTCCGGTTCCAGG - Intergenic
1179823805 21:43952611-43952633 GACCAAGATGTGCTGGCGCCAGG + Intronic
1183307535 22:37090654-37090676 AACCCAGATGTGTCTGGCCCAGG - Intronic
1184680811 22:46071381-46071403 AACCCAGGAGGGGCGGCGCCCGG + Intronic
1185087510 22:48748845-48748867 AACCCAGGTGGGCAGGTGCCTGG + Intronic
962821125 3:139047864-139047886 AAACCAGATGTGTCTGCCCCAGG - Intronic
966861642 3:184233850-184233872 AACCCAGATGTTCCGGAGGCTGG - Intronic
969114911 4:4865439-4865461 AACCCAGATTTGCCAGAGCCGGG - Intergenic
969844216 4:9907317-9907339 AGCCAAGAAGTGCCGGAGCCAGG + Intronic
990753033 5:59039075-59039097 AGCCCTCATGTGCCGGCACCGGG - Intronic
997053457 5:130411180-130411202 AACCTAGATGTTCCAGCACCTGG - Intergenic
997875025 5:137538507-137538529 ATCCCAGATGTGATGGCGGCCGG + Intronic
1006908622 6:37549438-37549460 AAACCAGGTGTGCAGGCCCCTGG - Intergenic
1016934230 6:149436857-149436879 AGCCCTGAGGTGCCGGGGCCCGG + Intergenic
1019309228 7:352200-352222 ACCCCACAGGTGCCGGAGCCTGG - Intergenic
1019487519 7:1296166-1296188 CACCCCGATGGGCCGGCACCGGG - Intergenic
1022515432 7:30972153-30972175 GACCCAGATGTGCCTGCGTCAGG + Intronic
1023987291 7:45104215-45104237 GACCCAGGTGTCCCAGCGCCTGG - Exonic
1026771827 7:73206983-73207005 AACCCTGAGGTGCCAGCGCGGGG + Intergenic
1027012695 7:74760379-74760401 AACCCTGAGGTGCCAGCGCGGGG + Intronic
1027075345 7:75185674-75185696 AACCCTGAGGTGCCAGCGCGGGG - Intergenic
1034901363 7:154909874-154909896 AATCCAGCTGTGCAGGGGCCCGG - Intergenic
1035106302 7:156444447-156444469 AACCCAGGTGTTCCGACGCGAGG - Intergenic
1036678028 8:10851151-10851173 AACCCAGGTGGGCTGGCCCCGGG + Intergenic
1036687793 8:10923438-10923460 AACCCAGATGTGCTGCTGACAGG - Intronic
1039843661 8:41310481-41310503 CACACAGATGTGCTGTCGCCCGG - Intergenic
1044996291 8:97841017-97841039 ATCCCAGATGGGGCGGCGGCTGG + Intronic
1047529494 8:125662310-125662332 AACCCAGATCTCCTGGCTCCTGG + Intergenic
1049009878 8:139880226-139880248 AACCCAGGTGTGCAGGCGGCCGG + Intronic
1049097302 8:140556558-140556580 AGCCCAGAAGTGCCGGTGTCAGG - Intronic
1051602762 9:18891157-18891179 AAGCCAGATGTGGCGCCGCTTGG + Intronic
1061296765 9:129681115-129681137 AACCCAGCTTTGCCGGAGCCCGG - Intronic
1061937809 9:133867849-133867871 CACTCAGCTGAGCCGGCGCCAGG - Intronic
1062009833 9:134261044-134261066 GACCCAGATGGGGTGGCGCCGGG - Intergenic
1192208309 X:69110404-69110426 AAGCCAGATCTCCCGGCACCTGG - Intergenic
1195979011 X:110558615-110558637 ATCCCAGATGGGGCGGCGGCGGG + Intergenic
1200122487 X:153797718-153797740 AACCCAGGTGTCCTGGAGCCTGG + Exonic