ID: 1141957660

View in Genome Browser
Species Human (GRCh38)
Location 16:87383423-87383445
Sequence TCCAGATGGTGTCGGTGTGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 162}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141957652_1141957660 7 Left 1141957652 16:87383393-87383415 CCGCGCGCTCACCCTCACGGCAA 0: 1
1: 0
2: 0
3: 2
4: 52
Right 1141957660 16:87383423-87383445 TCCAGATGGTGTCGGTGTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 162
1141957651_1141957660 8 Left 1141957651 16:87383392-87383414 CCCGCGCGCTCACCCTCACGGCA 0: 1
1: 0
2: 1
3: 4
4: 88
Right 1141957660 16:87383423-87383445 TCCAGATGGTGTCGGTGTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 162
1141957648_1141957660 10 Left 1141957648 16:87383390-87383412 CCCCCGCGCGCTCACCCTCACGG 0: 1
1: 0
2: 3
3: 5
4: 101
Right 1141957660 16:87383423-87383445 TCCAGATGGTGTCGGTGTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 162
1141957642_1141957660 23 Left 1141957642 16:87383377-87383399 CCCGGCCCCGCCACCCCCGCGCG 0: 1
1: 0
2: 10
3: 126
4: 916
Right 1141957660 16:87383423-87383445 TCCAGATGGTGTCGGTGTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 162
1141957647_1141957660 13 Left 1141957647 16:87383387-87383409 CCACCCCCGCGCGCTCACCCTCA 0: 1
1: 0
2: 1
3: 33
4: 436
Right 1141957660 16:87383423-87383445 TCCAGATGGTGTCGGTGTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 162
1141957644_1141957660 18 Left 1141957644 16:87383382-87383404 CCCCGCCACCCCCGCGCGCTCAC 0: 1
1: 1
2: 1
3: 33
4: 382
Right 1141957660 16:87383423-87383445 TCCAGATGGTGTCGGTGTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 162
1141957640_1141957660 27 Left 1141957640 16:87383373-87383395 CCCTCCCGGCCCCGCCACCCCCG 0: 1
1: 1
2: 18
3: 152
4: 1465
Right 1141957660 16:87383423-87383445 TCCAGATGGTGTCGGTGTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 162
1141957653_1141957660 -4 Left 1141957653 16:87383404-87383426 CCCTCACGGCAACGCCTCCTCCA 0: 1
1: 1
2: 0
3: 7
4: 119
Right 1141957660 16:87383423-87383445 TCCAGATGGTGTCGGTGTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 162
1141957641_1141957660 26 Left 1141957641 16:87383374-87383396 CCTCCCGGCCCCGCCACCCCCGC 0: 1
1: 2
2: 32
3: 356
4: 2632
Right 1141957660 16:87383423-87383445 TCCAGATGGTGTCGGTGTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 162
1141957643_1141957660 22 Left 1141957643 16:87383378-87383400 CCGGCCCCGCCACCCCCGCGCGC 0: 1
1: 0
2: 18
3: 206
4: 1403
Right 1141957660 16:87383423-87383445 TCCAGATGGTGTCGGTGTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 162
1141957654_1141957660 -5 Left 1141957654 16:87383405-87383427 CCTCACGGCAACGCCTCCTCCAG 0: 1
1: 0
2: 2
3: 11
4: 152
Right 1141957660 16:87383423-87383445 TCCAGATGGTGTCGGTGTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 162
1141957645_1141957660 17 Left 1141957645 16:87383383-87383405 CCCGCCACCCCCGCGCGCTCACC 0: 1
1: 0
2: 1
3: 39
4: 385
Right 1141957660 16:87383423-87383445 TCCAGATGGTGTCGGTGTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 162
1141957650_1141957660 9 Left 1141957650 16:87383391-87383413 CCCCGCGCGCTCACCCTCACGGC 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1141957660 16:87383423-87383445 TCCAGATGGTGTCGGTGTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 162
1141957646_1141957660 16 Left 1141957646 16:87383384-87383406 CCGCCACCCCCGCGCGCTCACCC 0: 1
1: 0
2: 4
3: 78
4: 743
Right 1141957660 16:87383423-87383445 TCCAGATGGTGTCGGTGTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 162
1141957639_1141957660 28 Left 1141957639 16:87383372-87383394 CCCCTCCCGGCCCCGCCACCCCC 0: 1
1: 1
2: 49
3: 404
4: 3342
Right 1141957660 16:87383423-87383445 TCCAGATGGTGTCGGTGTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141957660 Original CRISPR TCCAGATGGTGTCGGTGTGG AGG Exonic
904092602 1:27955824-27955846 TCCGAAAGCTGTCGGTGTGGTGG - Exonic
904913987 1:33956632-33956654 GACTGATGGTGTGGGTGTGGGGG - Intronic
910401156 1:86839371-86839393 TTCAGATGGTGAGAGTGTGGCGG + Intergenic
911651933 1:100398810-100398832 GCCTGTTGGTGTGGGTGTGGAGG + Intronic
922950497 1:229555039-229555061 TTCAGTTGGTGCCTGTGTGGAGG - Intronic
1063171689 10:3515314-3515336 TCTAGCTGGTGTGTGTGTGGTGG - Intergenic
1063665536 10:8058378-8058400 TCCAGGGGGAGGCGGTGTGGTGG - Exonic
1063726339 10:8641629-8641651 TCCGGATGATGTCGGTGCTGTGG - Intergenic
1067211568 10:44263906-44263928 TCCAGATGGGGTGGGGGAGGAGG + Intergenic
1069202305 10:65635418-65635440 AGCATATGGTGTGGGTGTGGGGG - Intergenic
1071168896 10:82840325-82840347 TCAAGATGGTCTAGGTGGGGTGG - Intronic
1074355419 10:112778447-112778469 TCCAGATGGTATCGGGGTTGTGG - Intronic
1075291853 10:121237922-121237944 TCCATCAGGTGTCAGTGTGGTGG + Intergenic
1075558970 10:123454704-123454726 GCCAGATGGTGCCAGTGTGAGGG - Intergenic
1075587480 10:123668059-123668081 TCCAGATGGTGTCGCAGGTGAGG + Intronic
1076930222 10:133527445-133527467 TCCTGCTGGTGTCCATGTGGAGG + Exonic
1077014192 11:392729-392751 ACCAGGTGGGGTCGGGGTGGTGG - Intronic
1077425652 11:2474803-2474825 TGCAGATTGTGATGGTGTGGTGG + Intronic
1078086876 11:8239223-8239245 GCCAGATGGTGCTGGGGTGGGGG + Intronic
1078665894 11:13324903-13324925 GCCAGCTGGTGGCAGTGTGGGGG + Intronic
1079309216 11:19349648-19349670 TCCTGATGGTGCTGGTGTTGGGG + Intergenic
1079481298 11:20883170-20883192 TCAGGATGGTGTCTTTGTGGGGG + Intronic
1083970066 11:66069552-66069574 TCAAGATGGTCTCGGGGTTGTGG + Exonic
1084697955 11:70767541-70767563 TCCACATTGTGGCGTTGTGGTGG - Intronic
1085644297 11:78213217-78213239 TCCAGATGGAGGCAGGGTGGCGG + Intronic
1087120298 11:94567429-94567451 TACAGATGGCGACGGTGTGACGG - Exonic
1088451981 11:109991788-109991810 TCCAGATGATGTCTTTGTGGAGG - Intergenic
1089415829 11:118289632-118289654 TCCAGATGGTTAAGGGGTGGAGG + Intergenic
1090428102 11:126624192-126624214 GCCAGGGGGTGGCGGTGTGGCGG + Intronic
1090744068 11:129692804-129692826 TCCAGAAGGAGTGGGTGAGGAGG - Intergenic
1091396686 12:157570-157592 TGAAGATGGTGTCGGGGTTGTGG - Exonic
1091596607 12:1882890-1882912 TCCAGATGATGTCGTGGTCGTGG + Exonic
1093478581 12:19582012-19582034 TCCTGGTGGTGGAGGTGTGGGGG + Intronic
1093758576 12:22880436-22880458 GCCAGATGGTGTCTGGGTGTAGG + Intergenic
1097527839 12:60761242-60761264 TCCAGATGGTTTCAGTGTAAAGG + Intergenic
1097664300 12:62462216-62462238 CCCAAGTGGTGTCTGTGTGGTGG + Intergenic
1101158565 12:101951217-101951239 TGCTGATTGTGTCGCTGTGGTGG + Intronic
1101593078 12:106139770-106139792 TCCAGATGGTGTCGGAGGGCCGG - Exonic
1101709142 12:107248811-107248833 TGCAGGTGGGGTGGGTGTGGGGG - Intergenic
1102362039 12:112296449-112296471 TGCAGATGGTGTAGGTGCAGAGG + Intronic
1102362057 12:112296584-112296606 TGCAGATGGTGTAGGTGCAGAGG + Intronic
1102362076 12:112296720-112296742 TGCAGATGGTGTAGGTGCAGAGG + Intronic
1102362084 12:112296780-112296802 TGCAGATGGTGTAGGTGCAGAGG + Intronic
1102362103 12:112296900-112296922 TGCAGATGGTGTAGGTGCAGAGG + Intronic
1102362116 12:112296990-112297012 TGCAGATGGTGTAGGTGCAGAGG + Intronic
1111855187 13:93628241-93628263 TCCAGATGCATTCTGTGTGGTGG + Intronic
1116504029 14:45655656-45655678 TAAAGCTGGTGTGGGTGTGGGGG - Intergenic
1119523031 14:75300212-75300234 TAGAGATGGTGTGTGTGTGGGGG + Intergenic
1120250458 14:82057054-82057076 TCCAGAAGGGGTGGGTGGGGTGG + Intergenic
1120818095 14:88884140-88884162 TCCACATGGTGTTGGTTTGCAGG - Intergenic
1122184660 14:99982002-99982024 TCCAGCTGATGTCGGGGTGAGGG + Intronic
1122756511 14:103984690-103984712 CCCAGTTGGAGTCTGTGTGGAGG - Intronic
1124366483 15:29075249-29075271 TGCAGATGGTGTGTGTGTGGGGG + Intronic
1125201857 15:37107126-37107148 GCGAGATGGAGTCGGAGTGGGGG + Intergenic
1125334360 15:38613238-38613260 TGCAGAGGGTGTGGGGGTGGTGG - Intergenic
1126487930 15:49203336-49203358 GGCAAATGGTCTCGGTGTGGTGG - Intronic
1127796414 15:62442153-62442175 TGGACATGGTGTCGGGGTGGCGG - Intronic
1128786795 15:70403542-70403564 TCCATATGGTGACAGTGTGGGGG - Intergenic
1129506207 15:76083592-76083614 TCTAGATGGTGTGGGGGTGAGGG - Intronic
1129758227 15:78111507-78111529 TGCTGATGGGGTGGGTGTGGTGG - Intronic
1130682148 15:86006278-86006300 TCCAGGTGTTCTCAGTGTGGTGG + Intergenic
1130721882 15:86395338-86395360 ACCAGATGGAGACGGTGAGGAGG - Intronic
1131098330 15:89669815-89669837 TACAGATGGGGTGGGGGTGGGGG + Intronic
1133987248 16:10677809-10677831 TCCAGATGGTTTCAGCCTGGAGG - Intronic
1135532155 16:23264020-23264042 TCAAGAAGGTGTGGGCGTGGTGG - Intergenic
1136347619 16:29686277-29686299 TGCAGACAGTGTCGGGGTGGGGG - Intronic
1139361778 16:66403947-66403969 TCCAGAGGGGGTGGGTGTGGAGG - Exonic
1141957660 16:87383423-87383445 TCCAGATGGTGTCGGTGTGGAGG + Exonic
1142210816 16:88807677-88807699 TCCAGAGGCTGCAGGTGTGGAGG - Intronic
1143580790 17:7824453-7824475 TCCACCTGGTGTTGGGGTGGGGG - Intronic
1145267978 17:21389644-21389666 TGCAGAGGGTGGGGGTGTGGTGG + Intronic
1145993948 17:29095106-29095128 TCCTGACAGTGTCTGTGTGGGGG - Intronic
1147539659 17:41346655-41346677 TCCAGAGAGTCTCGCTGTGGTGG + Exonic
1147541610 17:41364986-41365008 TCCAGAGAGTATCGCTGTGGTGG + Exonic
1147543294 17:41379163-41379185 TCCAGAGAGTCTCGCTGTGGTGG + Exonic
1147545087 17:41395055-41395077 TCCAGAGAGTCTCGCTGTGGTGG + Exonic
1147565877 17:41536220-41536242 GGCAGATGGTGTGGGTGGGGAGG + Intergenic
1149001313 17:51760460-51760482 TGGAGATGGTGGCGGTATGGAGG + Intronic
1150165672 17:62940255-62940277 GCCAGATGGGCTGGGTGTGGTGG + Intergenic
1150284606 17:63947835-63947857 TCCAGAGGCTGTCAGTGTGGCGG - Intronic
1150812015 17:68364028-68364050 CCCAGATGGTGCCTGGGTGGAGG - Intronic
1151166207 17:72205795-72205817 TCCAGCTGCTGTCAGGGTGGTGG + Intergenic
1151630797 17:75309500-75309522 TCCAGGTGTTGTCAGTGTGGAGG - Intergenic
1152224338 17:79085776-79085798 TCCAGCTGGAGTGGGGGTGGAGG + Intronic
1156850829 18:41724333-41724355 TCATCATGGTGTCAGTGTGGTGG - Intergenic
1159307395 18:66661974-66661996 TCATGTTGGTGTCTGTGTGGTGG - Intergenic
1160136972 18:76280575-76280597 TAAAGATGGGGTGGGTGTGGAGG - Intergenic
1160308882 18:77769693-77769715 TCCTGATGGCATCAGTGTGGTGG + Intergenic
1160546019 18:79656324-79656346 TCCGGAGGGTGTGCGTGTGGAGG - Intergenic
1161384517 19:3983862-3983884 TCCAGATATTGTAGGAGTGGGGG + Intronic
1161550776 19:4910870-4910892 TCCACATGGTGTCGGCGCTGAGG - Exonic
1163154091 19:15430766-15430788 TCCAGAAGCAGTGGGTGTGGTGG - Intronic
1164711220 19:30358425-30358447 TCCAGCTTGTGTCTGGGTGGTGG + Intronic
1165318567 19:35072486-35072508 TCCAGATGCTGGCGGTGTTCTGG + Intergenic
1165322111 19:35092163-35092185 TACAAATGGTTTGGGTGTGGTGG - Intergenic
1167237707 19:48325215-48325237 CCCAGATGATGTCTGTCTGGAGG + Intronic
1168265667 19:55222814-55222836 CCCAGTAGGTGTAGGTGTGGGGG + Intergenic
930089149 2:47519366-47519388 TCCAGCTGGAGGCGGTGAGGCGG + Exonic
933174160 2:79157815-79157837 TCCAGATGCTGCCGGTGAGTAGG + Intronic
934556534 2:95289645-95289667 GCCAGATGAGGACGGTGTGGGGG - Exonic
938746984 2:134288841-134288863 TCCAGAAGGTGTGGGAGTAGGGG - Intronic
940029044 2:149241146-149241168 TCTAGCTTGTGTTGGTGTGGAGG + Intergenic
940519804 2:154730237-154730259 TCCAGTTGGAGTCAGTGGGGTGG - Intronic
942092249 2:172504572-172504594 TCCAGATAGTGTAGCTGAGGAGG + Exonic
943161036 2:184251676-184251698 ATAAGATGGTGTTGGTGTGGAGG - Intergenic
1170121650 20:12919024-12919046 TCCAGAGGGTGTCACTGTGATGG - Intergenic
1170845234 20:19956726-19956748 GCCATATGGGGTGGGTGTGGAGG - Exonic
1171174177 20:23038849-23038871 TGCAGGTGGTGGCGGGGTGGGGG + Intergenic
1172629460 20:36368182-36368204 TCCTGCTGGTGTCTGGGTGGAGG - Intronic
1174069618 20:47890332-47890354 TCTTGATTGTGTCTGTGTGGAGG + Intergenic
1174338808 20:49883290-49883312 TCGAGATGCTGTCCCTGTGGAGG - Intronic
1177155031 21:17492901-17492923 TGCAGATGTTCTCTGTGTGGTGG - Intergenic
1178676762 21:34637806-34637828 TGCAGATCTAGTCGGTGTGGAGG + Intergenic
1182548117 22:31087144-31087166 TCTACATGGTGGAGGTGTGGGGG + Intronic
1183408560 22:37642058-37642080 TCCAGATGGGGTGGGAGTGTGGG + Intronic
1184751272 22:46487912-46487934 TCCAGCTGATGAGGGTGTGGGGG + Intronic
950442422 3:13017949-13017971 TCCAGAAGGCGTGGGTGGGGAGG + Intronic
951026009 3:17830985-17831007 GCCAGATTTTGTGGGTGTGGTGG + Intronic
954330855 3:49889561-49889583 TCCAGAGGGGGTTGCTGTGGGGG + Intronic
956209858 3:66791627-66791649 TCCAGAAGGTATCTCTGTGGTGG - Intergenic
956770551 3:72522466-72522488 TCCAGAAGCTGTCTTTGTGGTGG - Intergenic
961378765 3:126483579-126483601 TGCAGAGGCTGGCGGTGTGGCGG - Intronic
967948881 3:194825067-194825089 TGCAGATGCTGTGGGGGTGGGGG - Intergenic
968649270 4:1753982-1754004 TCCCCATGGTGTCGGGCTGGGGG - Intergenic
969325415 4:6441290-6441312 TCACTGTGGTGTCGGTGTGGAGG - Intronic
973113791 4:46429102-46429124 TGCAGATGTTGTCGATGTGATGG + Intronic
978224669 4:106319273-106319295 TTTAGATGGTGTGGGTGGGGAGG + Intronic
978735038 4:112076065-112076087 CCCAGATGGTGTTGCTGTGCCGG - Intergenic
979200508 4:117972386-117972408 TCCAGGTGGTGACAGTGAGGAGG - Intergenic
980227219 4:130002126-130002148 TAAAGATGGTCTGGGTGTGGTGG + Intergenic
981856590 4:149301005-149301027 TCCAGATAGTGTCAGGATGGGGG + Intergenic
985606273 5:859832-859854 TCCAGTTCGTGTCGGTTGGGGGG + Intronic
986068049 5:4255336-4255358 TCAAGAAGGGGCCGGTGTGGTGG - Intergenic
994112641 5:96024282-96024304 TCCAGAAGGTAGCGGTGGGGAGG + Intergenic
999377034 5:151094050-151094072 TCCAGAGGGTGGGGATGTGGAGG - Intergenic
999444556 5:151628776-151628798 TCCAGAGGTTCTGGGTGTGGTGG - Intergenic
1002060272 5:176621562-176621584 TCCAAATGGTGGAAGTGTGGAGG - Intronic
1002508088 5:179694456-179694478 TCCAGATGGTGGCCTTTTGGGGG - Intronic
1002779282 6:354003-354025 TGCAGATGGTGGGGGAGTGGAGG + Intergenic
1004742031 6:18471503-18471525 TCCAGGTGGTGTGGGGTTGGAGG + Intergenic
1004899923 6:20184325-20184347 TGCAGATGGGGTTGGTGAGGGGG + Intronic
1013910691 6:115272625-115272647 TCCACATGGTGTTGGGCTGGAGG + Intergenic
1014474745 6:121858476-121858498 TCCAGATGGTGGCCTTTTGGGGG + Intergenic
1018179536 6:161209173-161209195 TCCAGAGGGTGCTGGAGTGGGGG - Intronic
1019056360 6:169226221-169226243 CACGGATGGTGACGGTGTGGGGG - Exonic
1019772116 7:2890267-2890289 TCCAGATGGGCTCGTTTTGGAGG + Intergenic
1020236511 7:6359943-6359965 TCCATATGGTTTGGGTGGGGTGG + Intergenic
1020407682 7:7855435-7855457 TCCAGGTGGTGTTGGTCTTGGGG - Intronic
1022499853 7:30875931-30875953 TGCAGCTGGTGTCTGTGTGGTGG + Intronic
1022978220 7:35577788-35577810 TCCAGATAATGTGGGTATGGTGG - Intergenic
1023025991 7:36049891-36049913 TGCAGGTGGTCTCTGTGTGGTGG + Intergenic
1023292246 7:38680527-38680549 TGCAGATGTGGTCAGTGTGGTGG - Intergenic
1025753722 7:64314432-64314454 TCCAGATTGTGTGGGGGTGTTGG + Intronic
1033896279 7:146074263-146074285 TCCAGAAGGTGGGGGAGTGGGGG - Intergenic
1034266856 7:149785300-149785322 ACCAGAAGGGGTCGGGGTGGTGG + Intergenic
1035063639 7:156089569-156089591 TCCAGACAGTGTGGGTGTGTGGG + Intergenic
1036723593 8:11200575-11200597 TGCAGATGGGGCAGGTGTGGAGG - Exonic
1038446969 8:27611187-27611209 TGCAGATGGATTCGGTGTGAAGG - Intronic
1053219910 9:36303830-36303852 TCCAGATGGTGGCCTTTTGGGGG + Intronic
1059425477 9:114218280-114218302 TCCAGATCATGTCTTTGTGGGGG - Intronic
1060552574 9:124492609-124492631 CCCTGCTGGTGCCGGTGTGGGGG - Intronic
1186399537 X:9244548-9244570 TCCAGCTGGGGTGGGGGTGGGGG - Intergenic
1189285722 X:39850949-39850971 TCCAGATGGTGTGGGGGGAGGGG - Intergenic
1189398614 X:40645555-40645577 GGAAGATGGTGTAGGTGTGGTGG + Intronic
1190179519 X:48180104-48180126 TTCAGATGGTTGCGGGGTGGCGG + Intergenic
1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG + Intergenic
1190837186 X:54112127-54112149 TCAAGATGGGCTGGGTGTGGTGG + Intronic
1196014959 X:110929385-110929407 CTCAGATGTTGTCGGTGTGTAGG - Intergenic
1198074079 X:133178098-133178120 TCCAGGTGGTGGGGGTGAGGGGG - Intergenic
1199951931 X:152714459-152714481 TGAAGATGGTGTTGGTGTAGGGG - Intergenic
1199957752 X:152753989-152754011 TGAAGATGGTGTTGGTGTAGGGG + Intergenic
1200166415 X:154038681-154038703 TCAAGATTGTGTGTGTGTGGGGG - Intronic
1200907168 Y:8495684-8495706 CTCAGGTGATGTCGGTGTGGGGG + Intergenic