ID: 1141958828

View in Genome Browser
Species Human (GRCh38)
Location 16:87391614-87391636
Sequence AGGCGCCGCGGCAGGGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 257}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141958821_1141958828 -10 Left 1141958821 16:87391601-87391623 CCAGGAGAGTTCCAGGCGCCGCG 0: 1
1: 0
2: 1
3: 2
4: 58
Right 1141958828 16:87391614-87391636 AGGCGCCGCGGCAGGGGGACTGG 0: 1
1: 0
2: 1
3: 29
4: 257
1141958817_1141958828 17 Left 1141958817 16:87391574-87391596 CCTAACGGTAGGAAAATCTTACA 0: 1
1: 0
2: 0
3: 11
4: 90
Right 1141958828 16:87391614-87391636 AGGCGCCGCGGCAGGGGGACTGG 0: 1
1: 0
2: 1
3: 29
4: 257
1141958816_1141958828 27 Left 1141958816 16:87391564-87391586 CCACAGACGACCTAACGGTAGGA 0: 1
1: 0
2: 0
3: 2
4: 11
Right 1141958828 16:87391614-87391636 AGGCGCCGCGGCAGGGGGACTGG 0: 1
1: 0
2: 1
3: 29
4: 257
1141958820_1141958828 -7 Left 1141958820 16:87391598-87391620 CCACCAGGAGAGTTCCAGGCGCC 0: 1
1: 0
2: 0
3: 8
4: 108
Right 1141958828 16:87391614-87391636 AGGCGCCGCGGCAGGGGGACTGG 0: 1
1: 0
2: 1
3: 29
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141958828 Original CRISPR AGGCGCCGCGGCAGGGGGAC TGG Intronic
900147891 1:1166355-1166377 AGCCGCCTCTGCAGGGGGGCAGG - Intergenic
900185848 1:1332903-1332925 AGGAGCTGCGGGCGGGGGACGGG - Exonic
900240772 1:1616229-1616251 GGGCGCCGGCGCAGGGGAACGGG - Intronic
900297676 1:1960143-1960165 AGGCGGCTGGGCAGGGGGCCAGG - Intronic
900512673 1:3068013-3068035 AGGCGCTGCGGCGGAGGGGCCGG - Intergenic
900581829 1:3413271-3413293 AGCCACAGCGGCAGGGGGAATGG + Intronic
900981480 1:6048535-6048557 AGGCCCCGGGGCTGGAGGACGGG - Intronic
901049553 1:6419545-6419567 CGGAGCGGGGGCAGGGGGACGGG - Intronic
901650984 1:10743166-10743188 AGGGGCAGAGGCTGGGGGACAGG + Intronic
902173244 1:14629935-14629957 GGGCGGCGTGGCAGGGGGGCGGG - Intronic
902286220 1:15410187-15410209 AGACGCGGCGGCTGGGCGACTGG - Exonic
903879877 1:26501098-26501120 AGGGGCCGCGGGACGGGGAGGGG + Intergenic
904037918 1:27568689-27568711 CCGCGCCGCGGCCGGGGGAAAGG - Intronic
905779009 1:40691666-40691688 AGGCGCCAAGGGAGGGGGAAGGG + Intronic
907285483 1:53376958-53376980 AGGTGCTGGGGGAGGGGGACCGG - Intergenic
907351156 1:53832189-53832211 AGGCGCTGGGGGAGGGGGAGTGG - Intronic
908356779 1:63330126-63330148 AGTAGCCGCGGGACGGGGACGGG - Intergenic
909392981 1:75136668-75136690 AGGCGCCGGGGAAGAGGGACTGG + Exonic
910884589 1:91951453-91951475 AGGCGGGGCGGCAGGGTGGCGGG + Intronic
911514258 1:98847672-98847694 ATGGGCCGGGGCGGGGGGACAGG - Intergenic
912682489 1:111738423-111738445 AGGCCCCGCGGTACGGGGAGGGG - Intronic
912955569 1:114152683-114152705 GGGAGTCGCGGCAGGGGGAATGG - Exonic
913680915 1:121186526-121186548 AGGTGCCCCGGCCGGGGGTCTGG + Intronic
913979475 1:143497119-143497141 AGCCGCGGCGGCGGGGGGGCGGG - Intergenic
914032745 1:143974165-143974187 AGGTGCCCCGGCCGGGGGTCTGG + Intergenic
914156699 1:145093800-145093822 AGGTGCCCCGGCCGGGGGTCTGG - Intronic
915461955 1:156075696-156075718 AGGGGCAGGGGCAGGGGGAAGGG + Exonic
915916873 1:159945676-159945698 GGCCGCCGCGGGAGGGGGATTGG - Intergenic
916091918 1:161314327-161314349 AGGCGCGCCGGCTGGGGGTCGGG - Exonic
920468228 1:206205050-206205072 AGGTGCCCCGGCCGGGGGTCTGG + Intronic
923978962 1:239298424-239298446 TGGCGGGGCAGCAGGGGGACTGG - Intergenic
1064199299 10:13271364-13271386 AGGAGCCGAGACAGGGTGACAGG + Intergenic
1065140534 10:22714662-22714684 CGGCGCCGCGGGCGGGGCACTGG + Intergenic
1067342942 10:45419216-45419238 AGGCGCAGAGGCAGGGAGGCCGG + Intronic
1067458696 10:46441435-46441457 AGGTGCCCAGGCAGGGAGACGGG + Intergenic
1067628498 10:47943201-47943223 AGGTGCCCAGGCAGGGAGACGGG - Intergenic
1067684181 10:48457287-48457309 AGGCGGCCCGGCTGGGGGGCAGG - Intronic
1072549089 10:96463610-96463632 AGGCTCCCAGGCAGGGGGAGGGG + Intronic
1072926248 10:99620080-99620102 AGGCGCCGTGGCAGGGATCCTGG - Exonic
1073091141 10:100940796-100940818 AGGGGCAGGGGCAGGGGGAGGGG - Intronic
1075754754 10:124801909-124801931 AGCGGGCGCGGCAGGGGGCCCGG - Intronic
1076136569 10:128049250-128049272 AGTGGCCTCGGGAGGGGGACAGG + Intronic
1076314177 10:129529162-129529184 AGGGGCAGTGGCAGGGGGAGCGG + Intronic
1076898549 10:133325854-133325876 AGGCGGCGCGGAAGGCGGCCGGG - Exonic
1077339202 11:2018496-2018518 AGGCGCAGCGGCGTGGGGGCAGG + Intergenic
1078090806 11:8263279-8263301 GCGCGCCGCGGCAGGGGGCGAGG + Intronic
1078561659 11:12377842-12377864 AGGGGCCGGGGCACTGGGACCGG + Intronic
1080595917 11:33774326-33774348 AGGCGGTGAGGCAGGGGGAAAGG - Intronic
1081683159 11:45022937-45022959 AGGGGCCCAGGCAGGGGCACTGG + Intergenic
1083148151 11:60773697-60773719 AGGACTGGCGGCAGGGGGACTGG + Intronic
1083936588 11:65872809-65872831 CCGCGCCGCGGCAGGCGGGCGGG - Exonic
1084212211 11:67629513-67629535 TGGCGCCCCGGCAGGTGCACCGG + Intronic
1084979681 11:72822436-72822458 AGGCGCCGCGCCAGGGTCTCAGG + Intronic
1088587521 11:111372494-111372516 AGGCACTGTGGCAGGGAGACAGG + Intronic
1088613616 11:111602367-111602389 GGGGGCCGGGGCAGGGGGGCGGG - Intergenic
1089713596 11:120336063-120336085 AGGCGCCGCGGGAGGTGGGTGGG + Intergenic
1090265564 11:125351030-125351052 AAGCGCCGCTGCAGGGGTACCGG + Intronic
1090777050 11:129975007-129975029 AGGGGCCAGGGCAGGGGAACAGG + Intronic
1202822186 11_KI270721v1_random:73678-73700 AGGCGCAGCGGCGTGGGGGCAGG + Intergenic
1091589262 12:1833727-1833749 AGGGGCAGCGGCAGGGGCAGTGG + Intronic
1093583237 12:20807519-20807541 AGGAGGGGCGGCAGGGGGAGAGG + Intergenic
1094486077 12:30926826-30926848 GGGCGCCGCGGGAGGGGGCTGGG + Intronic
1095033423 12:37323467-37323489 AGGCACCGAGGCCGGGGGAGGGG - Intergenic
1096337072 12:50764439-50764461 GGGCGCAGCGGCAGGGGGAGGGG + Intronic
1097166741 12:57090039-57090061 AGGGGCCGTGGCAGGGGGAGGGG - Intronic
1098942964 12:76559152-76559174 AAAAGCCGCGGCAGGGGAACGGG - Intronic
1102008953 12:109606419-109606441 TGGCGGGGCGGCAGGGGCACCGG + Intergenic
1102964739 12:117117341-117117363 AGGGGCTGGGGCAGGGGGAGAGG - Intergenic
1104049495 12:125186285-125186307 CGGGGCCGCGGCCGGGGGAGGGG - Intergenic
1104964511 12:132502888-132502910 AGGGGGCACGGCAGGTGGACAGG - Intronic
1104987100 12:132603453-132603475 AGCGGCCGCGGAAGGAGGACGGG + Intronic
1104988475 12:132610964-132610986 AGGCGCCGCGGCAGGCTCAGCGG + Intergenic
1108485443 13:50918779-50918801 GGGTGCCGGGGCAGTGGGACGGG + Intronic
1109699668 13:66009387-66009409 AGGCGCGGCGGGGGGGGAACCGG + Intergenic
1113770105 13:112902816-112902838 AGACGCCCAGGCAGGGGCACTGG - Intronic
1113782046 13:112982448-112982470 AGGCTCCGTGGCAGGTGGCCGGG + Intronic
1113931663 13:113972031-113972053 AGGTGCCGCAGCAGGGAGGCCGG - Intergenic
1115149768 14:30270906-30270928 AGGCTCAGAGGCAGGGAGACTGG - Intergenic
1119219271 14:72893225-72893247 AGGCGCTGAGGCAGGCGGAGAGG - Intronic
1119349203 14:73950233-73950255 GGACGCCGCGGAAGCGGGACGGG + Exonic
1119519991 14:75278409-75278431 GGGGGCCGCGGCTGGGGGAGGGG - Intergenic
1119601892 14:75982266-75982288 GGGCGCCGGGGCTGGGGGAAAGG - Intronic
1120190666 14:81436560-81436582 GGGAGCCGGGGCGGGGGGACTGG + Intergenic
1122582165 14:102777679-102777701 AGGGGCCGCGGCGGGCGGGCGGG + Intronic
1122603028 14:102930570-102930592 AGCCGCCGCGGCAGGGGCTGCGG - Exonic
1122908603 14:104815502-104815524 AGGAGCGCCGGCAGGTGGACGGG - Intergenic
1123078313 14:105680208-105680230 AGGGGCAGGGGCAGGGGCACGGG - Intergenic
1124016088 15:25877070-25877092 CCACCCCGCGGCAGGGGGACTGG - Intergenic
1124244465 15:28057765-28057787 AGCCGCTGCTGCAGGGGAACAGG + Intronic
1125429319 15:39580357-39580379 GAGCGCCGCGGCAGCGGGAGAGG + Intergenic
1126800828 15:52295445-52295467 AGGCGCCGCGGAGGGGCCACGGG - Intronic
1127781861 15:62323563-62323585 AGGCGCTGGGACAGGGGGATGGG - Intergenic
1128760864 15:70215186-70215208 AGGCACCGGGGTAGGGGGACAGG + Intergenic
1129180263 15:73869758-73869780 AGGAGCCTGGGCTGGGGGACAGG + Intergenic
1129385895 15:75195969-75195991 GGGCGCCGAGGCCGGGGGAAGGG + Intronic
1129670415 15:77604753-77604775 AGAGGCCGCGGCATGGAGACGGG + Intergenic
1131113028 15:89777023-89777045 GGGCTCCGGGGCAGGCGGACGGG - Exonic
1131133071 15:89912568-89912590 GGGCGCGGCGGCAGGGGCGCCGG + Intronic
1132775755 16:1592929-1592951 AGGTGCCCCGGCAGAGTGACTGG + Intronic
1132829345 16:1919781-1919803 TGGAGCCGGGGCTGGGGGACTGG - Intergenic
1132893371 16:2215244-2215266 GAGCGCCGCGGGAGGGGGCCGGG + Intergenic
1133259427 16:4538561-4538583 AGGCGCCGCGGGCGGGGGCGGGG + Intronic
1136141853 16:28293261-28293283 GGACGCCGCGGCAGGGGGCCTGG - Exonic
1136449855 16:30347734-30347756 AGGCTCCCAGGCAGGGGGTCAGG - Intergenic
1136579614 16:31143440-31143462 AGGCCCCGCGGCCAGGGGCCTGG - Exonic
1136627820 16:31472502-31472524 AGGGGCCTCGGCCCGGGGACCGG + Intronic
1137579248 16:49623262-49623284 AGGCGCCTTGGCTGGGGGGCTGG - Intronic
1139972224 16:70783348-70783370 AGAGGCCGCGGCAGGAGGGCAGG - Intronic
1140009113 16:71112946-71112968 AGGGGCTGAGGCTGGGGGACAGG + Intronic
1141531369 16:84648807-84648829 GGGCGCCGCGGCCGGGGGAGGGG + Intronic
1141618974 16:85226661-85226683 AGGGGGCTCGGCATGGGGACTGG + Intergenic
1141679849 16:85537627-85537649 AGGCGCCTCGGAAGGGGGCTGGG - Intergenic
1141699090 16:85634293-85634315 AGGTGCTGGGGCAGGCGGACTGG - Intronic
1141946937 16:87317149-87317171 AGGCGCTGCTGCCGGGGGGCCGG - Exonic
1141958828 16:87391614-87391636 AGGCGCCGCGGCAGGGGGACTGG + Intronic
1142742841 17:1940971-1940993 AGGCCTTGCGGCAGGGGGACGGG + Intronic
1142860126 17:2756030-2756052 CGCCCCCGCGGGAGGGGGACGGG - Intergenic
1143747306 17:9003691-9003713 AGGCGCCGGGGCCGGGGCACCGG - Intergenic
1143893544 17:10120093-10120115 CGGGGCGGGGGCAGGGGGACAGG - Intronic
1145247574 17:21279754-21279776 AGGGGCTGGGGCAGGGGCACTGG + Intergenic
1145265160 17:21376501-21376523 AGTAGCCGGGGGAGGGGGACTGG + Exonic
1145938004 17:28726321-28726343 AGGGGCGGGGGCAGGCGGACGGG - Intronic
1147943422 17:44066290-44066312 AGGGCCCGCGGGAGGGGGAGGGG + Intronic
1148050822 17:44769254-44769276 TGGGGCCGGGGTAGGGGGACAGG + Intronic
1148614669 17:48991216-48991238 AGGGGCAGGGGCAGGGGGAGGGG + Intergenic
1148618437 17:49016806-49016828 AGGCGGGGGGGCAGGAGGACAGG - Intronic
1149582299 17:57759094-57759116 AGCAGCCGGGGCAGGGGGACAGG + Intergenic
1151651922 17:75475521-75475543 AGGGGCCGAGGCATGGGGAGTGG - Intronic
1152067975 17:78121901-78121923 GGGCCTCTCGGCAGGGGGACTGG - Intronic
1152322846 17:79617876-79617898 AGGCGGCGGGGCAGTGGGGCTGG - Intergenic
1152821594 17:82440302-82440324 AGGCGCGGCGGCCCAGGGACGGG + Intronic
1153223324 18:2880445-2880467 GGGCGAGGCGGCAGGGCGACAGG + Intronic
1153285195 18:3450093-3450115 CGGCGGGGCGGGAGGGGGACGGG + Intronic
1155519886 18:26657048-26657070 AGGGGCCGCGGCCGGGGGCCGGG - Intronic
1157550202 18:48576072-48576094 AGGCGCCGCTGCCCGAGGACCGG - Intronic
1160956988 19:1698407-1698429 AGGTGCCTCTGCAGTGGGACGGG + Intergenic
1161155864 19:2731702-2731724 TGGCGCCGCGGAAGGGAGCCGGG - Intronic
1161412510 19:4124198-4124220 AGGCGCGGCGGCTGGGGGTGGGG - Intergenic
1161795053 19:6381561-6381583 AGGCGCCGCAGCAGGAGGAGGGG - Exonic
1162964683 19:14150309-14150331 AGGCCGCAGGGCAGGGGGACTGG - Exonic
1165871479 19:38975991-38976013 AGACGCCCCCGCGGGGGGACTGG + Intergenic
1166666519 19:44683637-44683659 AGGTGTCCTGGCAGGGGGACAGG + Exonic
1166828445 19:45623921-45623943 AGGGGCTGAGGCAGGAGGACTGG - Intronic
1166984142 19:46649575-46649597 AGGCGCCGCCGCCGGGGGGCGGG - Exonic
1167607891 19:50491276-50491298 CGGGGACGCGGGAGGGGGACAGG + Intergenic
1168277108 19:55284398-55284420 AGGGGGGGCGGCCGGGGGACCGG + Exonic
926305806 2:11636766-11636788 AGGGGCAGGGGCAGGGGCACGGG + Intronic
929966759 2:46542627-46542649 GGGCGCCGCGGGAGGGGCCCGGG + Intronic
932191040 2:69741877-69741899 AGGGGGCGAGGCCGGGGGACCGG + Intronic
932331420 2:70900420-70900442 GGGCTCCGCGCCAGGGGGAGAGG - Intergenic
932402344 2:71489652-71489674 AGGCGCCTGGGGAGGGGGCCTGG + Intronic
932620120 2:73260259-73260281 AAGGGCAGAGGCAGGGGGACAGG - Intronic
933585770 2:84178078-84178100 AGGCGAGACGGCAGGGGGGCGGG - Intergenic
934045498 2:88170167-88170189 AGGGGCCGCGGGAGGGGCACAGG + Intergenic
935196489 2:100819796-100819818 GGGCGCCGGGGCTGGGGGAGGGG - Intergenic
938343398 2:130549790-130549812 ACGCGCAGCGGCAGGAGGATTGG + Exonic
938346435 2:130570932-130570954 ACGCGCAGCGGCAGGAGGATTGG - Exonic
938386784 2:130872450-130872472 AGGGGCCTGGGCAGGGGGCCTGG - Intronic
940300988 2:152176048-152176070 CGGCGGCGCGGCAGGGGGCGCGG + Intergenic
942748659 2:179264435-179264457 AGGCCCCGCGGCCGGGTGGCCGG - Intronic
945249285 2:207750355-207750377 ATGCGCCGGGACAGGGGGAGGGG + Intronic
946692608 2:222320250-222320272 ACGCGCCGGGGGCGGGGGACGGG - Intergenic
947506631 2:230712928-230712950 AGGCGCCGGGGCGGGGGCACAGG + Exonic
947754239 2:232550439-232550461 AGCCGCTGCGGGAGGGGGCCAGG + Exonic
948237364 2:236400931-236400953 AGGGGCCAGGGCAGTGGGACTGG - Intronic
948374648 2:237513353-237513375 AGGCACGGGGGTAGGGGGACTGG - Intronic
949013758 2:241697666-241697688 AGGGGCCTCGGGAGGGGGAGAGG + Intergenic
1168951287 20:1803622-1803644 GGGCGCCGCGGTAGGGGCACTGG + Intergenic
1169399884 20:5270828-5270850 GGGCTCAGCGGCAGGGGGCCTGG + Intergenic
1173813735 20:45971847-45971869 AGCCGCCTCCGCAGGGGAACCGG - Intronic
1174087372 20:48018754-48018776 AGGCCCTGGGGCAGGAGGACTGG - Intergenic
1174128916 20:48328216-48328238 AGGCCCTGGGGCAGGAGGACTGG + Intergenic
1174248312 20:49198960-49198982 TGGCGGGGGGGCAGGGGGACGGG - Intergenic
1176010802 20:62893910-62893932 AGGAGGCTGGGCAGGGGGACAGG + Exonic
1176856987 21:13981374-13981396 CGGCGCCGGGGTGGGGGGACTGG - Intergenic
1176867610 21:14062849-14062871 CGGCGCCGGGGTGGGGGGACTGG + Intergenic
1178882835 21:36462369-36462391 AGGAGCTGCGGCAGGAGCACGGG + Intronic
1179847669 21:44120260-44120282 AGGTGGGGCGGCATGGGGACAGG + Intronic
1180158605 21:45989390-45989412 AGGAGCCACGGCAGGGGCCCCGG - Intronic
1181701101 22:24621715-24621737 AGGCCAAGCGGCAGGGAGACTGG + Intronic
1182097346 22:27634928-27634950 GGGTGCAGCGGCAGGGGGACAGG - Intergenic
1184046715 22:41976726-41976748 GGGCGCCGCGGGAAGGGGAGGGG + Intronic
1184095522 22:42314330-42314352 AGCTGCCGCTGCCGGGGGACAGG + Intronic
1184978670 22:48080975-48080997 AGGCCCCACGGCAGAGGCACCGG + Intergenic
1185038239 22:48490469-48490491 TGGAGCCTCGGCAGGGGCACAGG - Intronic
950021713 3:9792417-9792439 AGGGGCCGCGGGAGGGGGCGGGG + Exonic
950102245 3:10365126-10365148 AGGAGCCGAAGCAGGGGGTCTGG + Intronic
953800757 3:46020906-46020928 AGGCGCAGGTGCAGGTGGACAGG - Exonic
953909172 3:46883180-46883202 AGGCGGCGCGGGAGGGGGGCGGG + Intronic
954121789 3:48504063-48504085 AGGATCCGCGGCGCGGGGACCGG + Exonic
961372583 3:126440629-126440651 AGGAGCAGGGGCAGGGGGAGGGG - Intronic
963236660 3:142963323-142963345 AGGCGCCGCGGCATGGTGCCCGG + Exonic
964612880 3:158632446-158632468 AGGGGCAGGGGGAGGGGGACTGG + Intergenic
968443739 4:637631-637653 AGGAGCCGCGGCCTGGGGGCCGG + Intronic
968452459 4:681787-681809 CTGCGCCGCGGGAGGGGGAGCGG - Intronic
968651177 4:1760873-1760895 AGGCGCCAAGGCTGGGGGCCAGG + Intergenic
968965490 4:3767239-3767261 AGGAGCCGATGCAGGAGGACAGG - Exonic
969114071 4:4860386-4860408 AGGCGCAGAGGGAGGGGGCCGGG + Intronic
969330741 4:6472362-6472384 GGGCATCGCGGCAGGGGGACGGG + Intronic
969724472 4:8911159-8911181 AGGCCCCGCAGCAGGAGGCCTGG - Intergenic
973993779 4:56436415-56436437 AGGCGCTGCTGCAGGGAGGCGGG - Intronic
975986182 4:80202911-80202933 AGGCGGCGCGGGCGGGGGCCAGG + Exonic
977884925 4:102243727-102243749 GGGCGCTGCTGCAGGGGGTCTGG - Intergenic
981033658 4:140150967-140150989 AGGCTCAGCCGCAGGGGGAGCGG + Intronic
982134404 4:152259502-152259524 AGGCCCTGTGGCAGGGGGAGGGG - Intergenic
986705506 5:10451349-10451371 AGGCCACCAGGCAGGGGGACAGG - Intronic
987050760 5:14144767-14144789 AGGCGCCGCCGCTGGGGTACCGG - Intronic
987373802 5:17217140-17217162 AGGCGGCGCGGCGGGGGAAGGGG + Intronic
987751065 5:22039009-22039031 TGGGGCAGTGGCAGGGGGACAGG - Intronic
988734654 5:34008107-34008129 CGGCGCCGCGGCTGGGGGCGTGG - Intronic
992088650 5:73299239-73299261 AAGCGTCGCCGCAGGGTGACTGG - Intergenic
995854235 5:116575791-116575813 GGGCGCAGCGGCAGGGGGAGGGG - Intergenic
1001481799 5:172093772-172093794 AGGGGCCACGACTGGGGGACTGG + Exonic
1001570256 5:172726050-172726072 AGGCCCTGCGGCTGGGGAACTGG - Intergenic
1002029369 5:176416547-176416569 GGGCGCCGCGGCGGGAGGAGCGG + Exonic
1002461068 5:179374105-179374127 AGGGGCCGAGGCAGGGAGCCAGG + Intergenic
1003272916 6:4623231-4623253 AGGGGAAGCGGCAGGGGGGCGGG + Intergenic
1003645414 6:7910248-7910270 GGGCGCCGCGGCTCGGGGCCGGG - Intronic
1004241318 6:13924972-13924994 AGGCGCCGCCGCAGCCGGAGCGG + Exonic
1005459695 6:26056387-26056409 AGGAGGCGCGGCAGCGGGAGCGG + Exonic
1005624717 6:27652877-27652899 AGGGGCAGAGGCAGAGGGACAGG - Intergenic
1005886625 6:30102223-30102245 AGGCGCCGCGGCCGGAGCAAAGG + Intergenic
1006614683 6:35318362-35318384 AGGCGCAGCGGCAGGCCGAGCGG + Exonic
1008469633 6:51869350-51869372 AGGGGCCGAGGAAGGGGGTCAGG - Intronic
1011751872 6:90461943-90461965 AGAGGCCACGGCTGGGGGACGGG - Intergenic
1013099514 6:106974936-106974958 GGGCGCCGCTGCAGGTGGGCGGG + Intronic
1014009739 6:116462046-116462068 AGGCGGCGCTGCACGGGCACTGG - Exonic
1016987697 6:149907483-149907505 AGGCCCTGAGGCAGGGGAACAGG + Intergenic
1017916570 6:158836155-158836177 AGGCTCAGCAGCAGGGGGGCAGG + Intergenic
1018203631 6:161416816-161416838 AGGCCCCTGGGCAGGAGGACGGG - Intronic
1018876713 6:167827417-167827439 ATACACCGCGGCAGGGGGACGGG - Intronic
1020004560 7:4775491-4775513 AGGTGCCGCGGCCGGGGGTCCGG - Intronic
1020106362 7:5423949-5423971 ATGCGCGGCGGCCGGGGGCCGGG - Intronic
1020130231 7:5555375-5555397 GGGGGTCGCGGCAGGGGGGCTGG - Intronic
1021311785 7:19106394-19106416 GTGCGCCGCGGCAGGGGGGCAGG - Intronic
1021963487 7:25895083-25895105 AGATGCCCCGGCAGGAGGACGGG + Intergenic
1023221170 7:37921067-37921089 AGGCGCCGCAGCAGTGGGAGGGG + Exonic
1024985870 7:55192623-55192645 AGGCGCCGGGCCTGGGGGACGGG + Intronic
1027248906 7:76386467-76386489 AGGAGCTGGGGCAGAGGGACTGG - Intergenic
1028280766 7:88925265-88925287 AGTCGCCTCGGCAGTGGCACAGG - Intronic
1028871198 7:95772909-95772931 AGGAGCCTGGGCAGGGGGCCAGG - Intronic
1029424361 7:100486962-100486984 TGGCGCTGCGGCAGGGGTGCGGG - Exonic
1033253182 7:139777781-139777803 CGGCGCCGGGGGAGGGGGCCGGG + Intronic
1034434760 7:151058146-151058168 CGGCGCCGCGGCGGGGCGCCCGG - Exonic
1036466561 8:9003122-9003144 AGTCGCCGCGGCCGGAGGGCGGG + Exonic
1037750766 8:21680776-21680798 AGGAGCCTCGGGAGGGGGAGGGG - Intergenic
1037787765 8:21912587-21912609 AGGAACCGTGGGAGGGGGACTGG + Intronic
1037799348 8:22024142-22024164 AGGCGCCGCGGCAGGGGGCGGGG - Exonic
1043891224 8:85654470-85654492 AGGGGCCGCGGCAGGGATTCCGG + Intergenic
1043892298 8:85661307-85661329 AGGGGCCGCGGCAGGGATTCCGG + Intergenic
1043893263 8:85716033-85716055 AGGGGCCGCGGCAGGGATTCCGG - Intergenic
1043895946 8:85737482-85737504 AGGGGCCGCGGCAGGGATTCCGG - Intergenic
1043896733 8:85744326-85744348 AGGGGCCGCGGCAGGGATTCCGG + Intergenic
1043899056 8:85762693-85762715 AGGGGCCGCGGCAGGGATTCCGG + Intergenic
1043900667 8:85774887-85774909 AGGGGCCGCGGCAGGGATTCCGG + Intergenic
1043902631 8:85790162-85790184 AGGGGCCGCGGCAGGGATTCCGG + Intergenic
1043904241 8:85802355-85802377 AGGGGCCGCGGCAGGGATTCCGG + Intergenic
1043905853 8:85814549-85814571 AGGGGCCGCGGCAGGGATTCCGG + Intergenic
1043907461 8:85826736-85826758 AGGGGCCGCGGCAGGGATTCCGG + Intergenic
1044306466 8:90645935-90645957 GGGCGCCGCGGCGGAGGGGCTGG - Exonic
1044343112 8:91070495-91070517 AGCCGCCGCGACTGGGGGAAGGG + Intronic
1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG + Intronic
1044773139 8:95658873-95658895 AGGCGCCAAGGCAGGGAGCCAGG - Intergenic
1045277736 8:100722324-100722346 AGGCGCCGCGGCCGGGGAAGCGG + Exonic
1045320928 8:101080808-101080830 GGGCGGCGCGGCAGGGCGCCGGG + Intergenic
1047961705 8:130016198-130016220 GGGCGCTGCGGCGGGTGGACAGG - Intronic
1049268579 8:141682415-141682437 AGGGGCCGGGGCAGGGGCAGAGG - Intergenic
1049366449 8:142239092-142239114 AGGCCCCCAGGAAGGGGGACTGG + Intronic
1049378912 8:142302399-142302421 AGGCCCCGAGGCATCGGGACCGG - Intronic
1050091311 9:2017729-2017751 TGGCGGCGCGGCCGGCGGACGGG - Intronic
1051206363 9:14693286-14693308 AGGTGGCGCGGCAGGAGGAGGGG - Exonic
1051845716 9:21449255-21449277 AGGCACCTAGGCAGGGGGAGTGG + Intergenic
1052072686 9:24101898-24101920 AGAGGCCGAGGAAGGGGGACTGG + Intergenic
1057313487 9:93955358-93955380 AGGCGCGGCGGCGTGGGGAGGGG - Exonic
1059339069 9:113587225-113587247 AGGGGCCGGGGGTGGGGGACTGG + Intronic
1059428407 9:114235671-114235693 AGGGGCAGGGGCAGGGGGAGGGG - Intronic
1059447990 9:114350918-114350940 AGGCGCAGCGGCAGGGGCGGGGG + Exonic
1060208266 9:121695231-121695253 GGGCCGCCCGGCAGGGGGACAGG - Intronic
1061157264 9:128871471-128871493 AGAGGCCGAGGCAGGAGGACTGG + Intronic
1062350836 9:136137917-136137939 TGGAGCCGTGGCAGGGTGACAGG - Intergenic
1062579074 9:137221694-137221716 AGGCTCCGCGGCAGGAGCAGAGG + Intergenic
1186669996 X:11758364-11758386 AGGTGCCGCCGCGGAGGGACAGG + Exonic
1189322841 X:40096962-40096984 AGGGGGCGCGGCTGGGGGCCTGG - Intronic
1192818059 X:74614709-74614731 AGGCTCCGCGGGAGGAGGAGGGG + Intergenic
1198158626 X:133985780-133985802 GGGCACCGCGGCGCGGGGACCGG + Intronic
1198518349 X:137429430-137429452 GGGCGCTGCGGCAGGGGGAGCGG - Intergenic
1199500291 X:148500375-148500397 AGGGGCCGTGGCAGGGATACAGG - Intergenic
1200158695 X:153993069-153993091 AGGGGCTGCAGGAGGGGGACTGG - Intergenic