ID: 1141959177

View in Genome Browser
Species Human (GRCh38)
Location 16:87392781-87392803
Sequence CACCCCGCCGCGGAGGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 198}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141959177_1141959197 27 Left 1141959177 16:87392781-87392803 CCCGCGCCCTCCGCGGCGGGGTG 0: 1
1: 0
2: 0
3: 14
4: 198
Right 1141959197 16:87392831-87392853 CCGCAAGCGCGCTGCGGGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 83
1141959177_1141959198 28 Left 1141959177 16:87392781-87392803 CCCGCGCCCTCCGCGGCGGGGTG 0: 1
1: 0
2: 0
3: 14
4: 198
Right 1141959198 16:87392832-87392854 CGCAAGCGCGCTGCGGGCGAGGG 0: 1
1: 0
2: 0
3: 5
4: 50
1141959177_1141959192 22 Left 1141959177 16:87392781-87392803 CCCGCGCCCTCCGCGGCGGGGTG 0: 1
1: 0
2: 0
3: 14
4: 198
Right 1141959192 16:87392826-87392848 CGCCCCCGCAAGCGCGCTGCGGG 0: 1
1: 0
2: 1
3: 3
4: 62
1141959177_1141959191 21 Left 1141959177 16:87392781-87392803 CCCGCGCCCTCCGCGGCGGGGTG 0: 1
1: 0
2: 0
3: 14
4: 198
Right 1141959191 16:87392825-87392847 CCGCCCCCGCAAGCGCGCTGCGG 0: 1
1: 0
2: 1
3: 3
4: 78
1141959177_1141959182 -8 Left 1141959177 16:87392781-87392803 CCCGCGCCCTCCGCGGCGGGGTG 0: 1
1: 0
2: 0
3: 14
4: 198
Right 1141959182 16:87392796-87392818 GCGGGGTGCCTGCCGTACCCCGG 0: 1
1: 0
2: 0
3: 3
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141959177 Original CRISPR CACCCCGCCGCGGAGGGCGC GGG (reversed) Intronic
900513353 1:3070368-3070390 CGCCTCACCGCGGATGGCGCCGG - Intronic
900513513 1:3070882-3070904 CACCCGGCAGCGGAGCGCGGCGG - Intronic
900638984 1:3679308-3679330 CATCCCTCCGCGCAGGGCTCAGG - Intronic
901068558 1:6506189-6506211 CACCCAGCCTCCGAGGGCGCGGG - Intronic
901109862 1:6785702-6785724 GACCCGGCCGGGGAGGGGGCCGG + Intronic
901483079 1:9539510-9539532 GGCCACGCCGCGGAAGGCGCGGG + Exonic
903921606 1:26804041-26804063 CACCCCGGCGGGGAGGGAGGTGG - Intergenic
905847124 1:41242256-41242278 CACCTCGCAGCGGGAGGCGCGGG - Intergenic
905995940 1:42380709-42380731 CAGCGCGCGGCGGCGGGCGCTGG - Intergenic
906427232 1:45724867-45724889 CACCCCGTCGGGGAGGGAGGTGG + Intronic
907140594 1:52181931-52181953 CACCCCGTCGGGGAGGGAGGTGG + Intronic
908131201 1:61077136-61077158 CAGCCTGCGGCGGAGGGGGCAGG - Intronic
910771511 1:90836221-90836243 CACCCCGCCCCGCCGGGGGCTGG - Intergenic
914666979 1:149840431-149840453 CCCCCCGCCACGCAGGGCCCCGG + Exonic
914668788 1:149853359-149853381 CCCCCCGCCACGCAGGGCCCCGG - Exonic
915165140 1:153944242-153944264 CAGCTGGCCGGGGAGGGCGCAGG + Exonic
915309948 1:155001840-155001862 CACCCCCTCTCGGAGGGAGCCGG - Intergenic
915458344 1:156054712-156054734 CGCCCCACCGCGGGGGGCTCTGG - Intergenic
915797551 1:158752522-158752544 CACCCCAACTCGGAAGGCGCAGG + Intergenic
916666924 1:166975339-166975361 CACCCCGCGGCAGCGGGCGGCGG + Intronic
917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG + Exonic
920022593 1:202967080-202967102 GACCCCGCCCCGCAGGGCTCTGG - Intronic
920376313 1:205510271-205510293 CACCCCGCAGCCCAGGGTGCTGG - Intronic
924172416 1:241356678-241356700 CCCCGCGCCGCGGCGGCCGCCGG + Intronic
1062807139 10:430350-430372 CACCCCTCCCAGGAGGTCGCTGG + Intronic
1064028798 10:11869984-11870006 TTCCCCGCCGCGGGGGACGCCGG + Exonic
1066093967 10:32055721-32055743 AACCCCGCCGGGGAGGGCTGGGG + Intronic
1066220804 10:33335319-33335341 TTCCTCGCCGCCGAGGGCGCGGG - Intronic
1066464748 10:35641810-35641832 CTCCCCGCCGCGCCGGGCGGCGG + Exonic
1067786519 10:49253484-49253506 CACCCAGCCCTGGAGGGTGCAGG - Intergenic
1067786577 10:49254721-49254743 CACCCAGCCCTGGAGGGTGCAGG - Intergenic
1067972710 10:50991280-50991302 CAGCCGGCAGCGGAGAGCGCGGG - Intergenic
1070877536 10:79827072-79827094 CACCTCGCCGCGGGCGGGGCTGG - Intergenic
1071617952 10:87094170-87094192 CACCCCGCCTCGGATGTGGCCGG - Intronic
1071644031 10:87343118-87343140 CACCTCGCCGCGGGCGGGGCTGG - Intergenic
1074130385 10:110568160-110568182 CACCCCGCCGGGGCGGCCGCGGG + Intronic
1076929478 10:133520494-133520516 CCTCCCGCCTCAGAGGGCGCGGG - Exonic
1081699891 11:45146494-45146516 CCCCCCTCCGGGCAGGGCGCGGG + Intronic
1082206002 11:49434599-49434621 GGCCACGCCGCGGAAGGCGCGGG - Intergenic
1082807084 11:57458378-57458400 CACCCCTCCCCGAAGAGCGCGGG + Intergenic
1085982784 11:81744657-81744679 CTCCCCGCCGGGCAGGGCTCGGG - Intergenic
1088604182 11:111512708-111512730 CTCCCGGCCTGGGAGGGCGCGGG + Intergenic
1091335320 11:134762148-134762170 CAGCCGGCCGCGGAGCCCGCAGG + Intergenic
1091648480 12:2291604-2291626 TACCCTGCAGTGGAGGGCGCAGG + Intronic
1092534575 12:9376266-9376288 CACGCTGCCGCGCAGGGAGCAGG + Intergenic
1096634331 12:52948996-52949018 CGGCCCGGGGCGGAGGGCGCGGG + Exonic
1097192189 12:57224929-57224951 CGCCCCGCCGCGGCCGGAGCGGG + Exonic
1098963655 12:76764079-76764101 CCTCCCCCCTCGGAGGGCGCGGG - Exonic
1103856005 12:123972224-123972246 GACCCCGCGGGGGCGGGCGCGGG + Intronic
1104928196 12:132324671-132324693 CACCCGGCTGCAGAGGGCGGCGG - Intronic
1104974485 12:132546334-132546356 CATCCCGCCCCGGAGGCTGCAGG - Intronic
1108370421 13:49762225-49762247 CGCCCCGTCGCGGAGGGAGGAGG + Intronic
1108688861 13:52845577-52845599 CACACCGCCACAGGGGGCGCCGG + Exonic
1110790579 13:79582385-79582407 CACCCCCCAGCGGAGGGAGGTGG - Intergenic
1111220943 13:85205183-85205205 CACCACGGGGCGGGGGGCGCTGG - Intergenic
1112344423 13:98577467-98577489 CACCCCGCCCCGGCGGCCTCTGG + Intronic
1112563251 13:100532245-100532267 CACTGCACCGCGGTGGGCGCTGG + Exonic
1113636382 13:111921654-111921676 CAGCCCGGCCAGGAGGGCGCCGG - Intergenic
1116594404 14:46820663-46820685 CACCCCGCGGGGCAGGGCTCGGG + Intergenic
1117131863 14:52695314-52695336 GTGCACGCCGCGGAGGGCGCCGG + Intronic
1117523985 14:56579483-56579505 CACCCCGCACCGTAGGGGGCAGG + Intronic
1117524101 14:56579982-56580004 CACGCCGCCGCGGATGCCCCCGG - Exonic
1117911496 14:60642105-60642127 CACCCCTCCTCAGAGCGCGCGGG + Intergenic
1119303661 14:73590609-73590631 CTCCCCGCGGCGCAGGGCTCGGG - Intergenic
1120309857 14:82814435-82814457 CACCCCGTCCCGGAGGGAGGTGG - Intergenic
1121350638 14:93170248-93170270 CTCCCCGCCGGGCAGGGCTCGGG - Intergenic
1121368038 14:93332682-93332704 CAAGCCGCCGCGGGAGGCGCTGG - Intronic
1122550110 14:102544939-102544961 CACCCCGCCCCGGAGGCCTCGGG - Intergenic
1122582187 14:102777745-102777767 GGCCCCGCCGCCCAGGGCGCGGG - Intronic
1122880326 14:104687957-104687979 CACCCCACCCTGGAGGGCACGGG - Intergenic
1122905694 14:104800590-104800612 CGCCCCGGCGGGGAGGGCGCGGG - Intronic
1124248990 15:28095276-28095298 CACCCGGGCGGGGAGTGCGCAGG - Intronic
1124629197 15:31327438-31327460 CGCTCCGCCGGGGCGGGCGCCGG - Exonic
1125640995 15:41230802-41230824 CTCCCGGCCGCAGGGGGCGCTGG - Intergenic
1125659280 15:41382760-41382782 CACCCCGTCGGGGAGGGAGATGG + Intergenic
1128264137 15:66253149-66253171 GACCCCGGCGGGGAAGGCGCCGG + Intronic
1132591111 16:726891-726913 GACCCCGCCGCGCCCGGCGCTGG - Intronic
1133188361 16:4116060-4116082 CTGCCCGCGGCGGCGGGCGCTGG + Exonic
1136919014 16:34245973-34245995 CACCCCGCCTGGGAGGGAGGTGG - Intergenic
1138591165 16:58000473-58000495 CGCGCCGCCGCGGATGGAGCCGG - Intronic
1139600308 16:67982453-67982475 CTCCCCGCCGGGCAGGGCTCGGG + Intergenic
1141742081 16:85900180-85900202 TCCCCCGCCTCGGAGGGCCCAGG - Intronic
1141959177 16:87392781-87392803 CACCCCGCCGCGGAGGGCGCGGG - Intronic
1142974801 17:3636913-3636935 CCCGCCGCGGCTGAGGGCGCTGG - Intronic
1143519480 17:7437421-7437443 CACCGCGGCACGGAGGGCCCGGG - Exonic
1144536389 17:16095373-16095395 CACCCCGCCCGGGAGGGAGGTGG + Intronic
1145418152 17:22741398-22741420 CACCCCGCCCGGGAGGGAGGTGG + Intergenic
1145962819 17:28897411-28897433 CACCGCGCGGCGCAGGGCGCTGG - Intronic
1146008418 17:29176834-29176856 CACGCCGCCGCGCGGGGAGCCGG + Intronic
1147393322 17:40122811-40122833 CAGCCGGCCGGGGAAGGCGCGGG - Intronic
1147927196 17:43953285-43953307 CACCCGGCAGCGGTGAGCGCAGG - Exonic
1149461561 17:56833785-56833807 CACCGCGCCGCGCGGGGCCCAGG - Exonic
1150168347 17:62966171-62966193 CACCCCAGCCCGGAGGGGGCGGG + Intergenic
1150388903 17:64779933-64779955 CACCCAGCCGGGGCGGGAGCGGG - Intergenic
1151570450 17:74923117-74923139 CCCCCCGCAGGGGAGGGCGGCGG + Exonic
1156350545 18:36298040-36298062 CCCCCTGCCGCGGTGCGCGCCGG + Intronic
1159105998 18:64002659-64002681 CACCCCGCCGCGGGAAGAGCAGG - Intronic
1160753679 19:747218-747240 CACCCCGCCAGAGAGGGCCCCGG + Exonic
1161108786 19:2456980-2457002 TGCCCCGCCGCGGCGGGCGGCGG - Exonic
1161736913 19:5997088-5997110 CACCGCGTCGCGGAGGCCACCGG - Exonic
1162045020 19:7993368-7993390 CACCCTGCTGCTGAGGGGGCAGG + Intronic
1162398365 19:10430811-10430833 GGCCCCGCCTCGGCGGGCGCTGG - Intronic
1162987123 19:14277836-14277858 CTCCCCGCCGGGCAGGGCTCGGG + Intergenic
1163945486 19:20530415-20530437 CACCCCGCCCAGGAGGGAGGTGG - Intergenic
1164168451 19:22702872-22702894 CACCCCGTCCCGGAGGGAGGTGG - Intergenic
1164186176 19:22871586-22871608 CACCCCGCCTGGGAGGGAGGTGG - Intergenic
1165928539 19:39342213-39342235 AATCCCGCCGAGGAGGGGGCGGG + Intronic
926095631 2:10079645-10079667 CACCCCTAGGCGGAGCGCGCCGG - Intronic
926474762 2:13308465-13308487 CTCCCCGCCGGGCAGGGCTCAGG - Intergenic
928314130 2:30232652-30232674 GACCCCGCCGCGGCTTGCGCCGG - Intronic
936163495 2:110101954-110101976 CACCGGGCCGCGGTGGGAGCAGG - Intronic
938537145 2:132256463-132256485 CACTCATGCGCGGAGGGCGCGGG + Intronic
939178678 2:138780458-138780480 CGCCCCTCCTCGGAGGGGGCCGG + Intergenic
940145769 2:150542690-150542712 CACCCCGCAGGGCAGGGCTCGGG - Intergenic
942454863 2:176130592-176130614 CACCCAGTCCCGGAGGGCGGCGG - Exonic
943906103 2:193502583-193502605 CTCCCCGCCGGGCAGGGCTCCGG - Intergenic
944154097 2:196593073-196593095 CAGCCCGCTGCGGAGGGCGGCGG - Intronic
944252467 2:197591688-197591710 CTCCCCGCCGGGCAGGGCTCAGG - Intronic
946692666 2:222320467-222320489 CACCACCCCGCGTAGGGGGCGGG - Intergenic
1170425024 20:16227856-16227878 CACCCCGTCGGGGAGGGAGGTGG - Intergenic
1171120907 20:22568345-22568367 GACCCCGCTGCGGTGGGAGCGGG - Intergenic
1171899820 20:30846983-30847005 CACCCCGCCCGGGAGGGAGGTGG - Intergenic
1172118528 20:32584904-32584926 CGGCCCGCCCCCGAGGGCGCCGG - Intronic
1175439703 20:58981690-58981712 CCGCCCGCCGCGGGGGTCGCAGG - Intronic
1176181577 20:63752044-63752066 CACCCCGAGGCGCAGGGTGCAGG - Intronic
1177182365 21:17757718-17757740 CACCCTGCCGGGCAGGGCTCGGG - Intergenic
1178832703 21:36069970-36069992 CGCCCGGCCGCTGAGCGCGCAGG - Exonic
1178915088 21:36701493-36701515 CACCCGGCAGCGGAGGGGGCTGG + Intronic
1180216146 21:46324707-46324729 CACCCGGTCCCGGAGGACGCGGG - Intronic
1180312765 22:11253116-11253138 CACTCATGCGCGGAGGGCGCTGG + Intergenic
1181283584 22:21736389-21736411 GACCCGGCCGCGGAGGGGTCCGG - Intergenic
1182260674 22:29071552-29071574 CCCGCCGCCGCGCCGGGCGCAGG + Intergenic
1183255307 22:36758020-36758042 CACCCTGCCGCGCAGTGGGCAGG + Intergenic
1183525017 22:38317528-38317550 GCCCCCAGCGCGGAGGGCGCGGG - Intronic
1183595246 22:38807183-38807205 CACCCCGCCCGGGAGGGAGGTGG + Intergenic
950253723 3:11487750-11487772 CACCCCGTCCGGGAGGGAGCTGG - Intronic
953257662 3:41306199-41306221 CACCCCGCCCGGGAGGGAGGTGG + Intronic
961459933 3:127043831-127043853 CACCCTGCAGGGGAGGGCACTGG - Intergenic
961962418 3:130868099-130868121 CACCCCGTCCCGGAGGGAGGTGG + Intronic
962318812 3:134374693-134374715 CACCGCGGCCTGGAGGGCGCTGG - Intronic
965404105 3:168249462-168249484 CACCCAGCCGCGGCGGGGGCTGG - Intergenic
965590430 3:170356967-170356989 CGCCCCGCCCCGGAGGCAGCCGG - Intergenic
965590828 3:170358307-170358329 CGCCCCCCCGCGGGGGCCGCGGG - Intronic
966882447 3:184357977-184357999 CATCCCGCTGCCTAGGGCGCAGG + Exonic
967904176 3:194487035-194487057 CATCCCCGCGCGGAGGGCGGAGG + Intronic
968983100 4:3861291-3861313 CACCCCACCCCGAAGGGCTCAGG + Intergenic
975848421 4:78548234-78548256 CACCCCGTCCCGGAGGGAGGTGG + Intergenic
976092425 4:81471975-81471997 CGCCCCGCCCCGGCAGGCGCGGG + Intronic
980130528 4:128812168-128812190 GACGCCGCTGCGGAGGGAGCGGG + Intronic
986683031 5:10250668-10250690 CACCCAGCTCCGAAGGGCGCTGG - Intronic
988509696 5:31854895-31854917 CACCGCGGCGCGGAGGGAGGAGG + Intronic
999386541 5:151157677-151157699 CACCGCGCAGCGGAGGCCTCGGG + Exonic
1000345853 5:160312635-160312657 CCCCCCGCCCCGCGGGGCGCGGG - Intronic
1002405011 5:179023883-179023905 CCCCCCGCCGAGGCGGGCCCAGG + Exonic
1003567290 6:7231587-7231609 CACCCCGCCGCTGTTGGCGCGGG - Exonic
1004709244 6:18155003-18155025 CACTCGGGCGCGGAGGGTGCGGG - Intronic
1004874542 6:19939948-19939970 CACCCCGCCTGGGAGGGAGGTGG + Intergenic
1004883720 6:20032558-20032580 CTCCCCGCCGGGCAGGGCTCCGG + Intergenic
1007631526 6:43275735-43275757 CACCCCACCACTGAGGGCCCTGG + Intronic
1008624737 6:53305388-53305410 CACCCCGCCCGGGAGGGAGGTGG - Intronic
1013793331 6:113859074-113859096 CACCGCGCCGCGTTGGGCGCAGG - Intronic
1015643553 6:135363776-135363798 CACCCCGTCCCGGAGGGAGGTGG - Intronic
1016438802 6:144063780-144063802 CGCCCCGCCACGGTGGGCGTGGG - Intronic
1018774328 6:166999290-166999312 CGCCCCGACGCGCAGCGCGCTGG - Exonic
1019407424 7:891015-891037 CACCTCGCTGCGGAAGCCGCGGG - Exonic
1020812615 7:12864725-12864747 CACCACTGCGCGGAGGGCACAGG - Intergenic
1024784059 7:52886212-52886234 CACCCAGCAGCGGAGCGGGCTGG + Intergenic
1024919389 7:54542222-54542244 CGGGCGGCCGCGGAGGGCGCAGG - Intergenic
1025032855 7:55571934-55571956 CTCCCCGCCGCAGAGGGCCGAGG - Intronic
1025078763 7:55964743-55964765 CGCCGCGAGGCGGAGGGCGCGGG + Intronic
1025796029 7:64738904-64738926 CACCCCGCCCGGGAGGGAGGTGG - Intergenic
1026360807 7:69599527-69599549 CTCCGCCCCGAGGAGGGCGCGGG - Exonic
1027232629 7:76281637-76281659 CGCCCCGCCGCAGGGGTCGCCGG + Exonic
1028382222 7:90212013-90212035 CTGCCCGGCGTGGAGGGCGCGGG + Exonic
1029482151 7:100819765-100819787 CTCCCGGCAGCGGAGGGCGTAGG + Exonic
1030262533 7:107580407-107580429 CACCGCGCCGCGGACCGGGCCGG - Intronic
1032459867 7:132102581-132102603 CCCACCCCCGCGGAGGGCGGGGG - Intergenic
1034440498 7:151083385-151083407 CACCCCGCCGCCCAGGGCCCCGG - Intronic
1034446239 7:151115572-151115594 CACAGCGGCGCGGCGGGCGCGGG - Intronic
1034494118 7:151410002-151410024 CGCTCGGCCGGGGAGGGCGCGGG - Intronic
1034800635 7:154053230-154053252 CACCGCGTCCCGGAGGGAGCGGG + Intronic
1035004513 7:155644951-155644973 GACCGCGCCGCGGTGGGCGGGGG + Intronic
1036788662 8:11703855-11703877 CATCCCGCAGCGGCGGGCGAGGG - Intronic
1042367297 8:67952189-67952211 AATCCCGGCGCGGGGGGCGCGGG - Exonic
1045489219 8:102656164-102656186 CAGCCCGCCACGGAGTGGGCGGG + Intergenic
1045674077 8:104589015-104589037 CCCGCAGCCGCGGAGAGCGCAGG - Intronic
1048009390 8:130443721-130443743 CGCTCGGCGGCGGAGGGCGCGGG + Intergenic
1048554033 8:135457771-135457793 GTCCCCGCCGCTGGGGGCGCGGG + Exonic
1049672005 8:143874043-143874065 CACCCTGCCCCGGGGGCCGCAGG + Intronic
1053114526 9:35489819-35489841 CACCCCGCGGGGGCGGGCGCGGG + Intergenic
1054905974 9:70413827-70413849 CACCCCGACGCGGGTGGCGAGGG + Exonic
1058439203 9:104991735-104991757 CTCCCAGCCGCGGCGGGCGGCGG + Intergenic
1059061423 9:111038314-111038336 GACCCCGGCGGGGTGGGCGCAGG - Intronic
1059118109 9:111617483-111617505 CACCCCGCCCGGGAGGGAGGTGG - Intergenic
1061365788 9:130172097-130172119 CTCCCCGCCGCGGCGGGGGCCGG + Intergenic
1061445211 9:130633683-130633705 CCCTCGGACGCGGAGGGCGCCGG - Intronic
1061717702 9:132531368-132531390 CCCCCCGCGTGGGAGGGCGCCGG + Intronic
1061737351 9:132670497-132670519 AAAACCGCCGCGGAGGGCGCTGG + Exonic
1062733428 9:138121521-138121543 CCCCCGGCCGCGGTGGGCGGAGG + Exonic
1185643019 X:1598803-1598825 CACAGCGGCGCGGAGGACGCCGG - Intronic
1185791257 X:2929309-2929331 CGCCCGGGCGCGGAGTGCGCAGG - Exonic
1187172922 X:16869756-16869778 CGCCCCGGGGCCGAGGGCGCCGG + Exonic
1187184157 X:16968529-16968551 CACCCCGTCCCGGAGGGAGGTGG - Intronic
1189310192 X:40013189-40013211 CGCCCCGCCGGGGCGGGAGCCGG + Intergenic
1190881460 X:54495401-54495423 CACCGAGCCCCGGGGGGCGCCGG - Exonic
1195896347 X:109749463-109749485 CTCCCCGCGGGGGAGGGCTCGGG - Intergenic
1200163336 X:154020013-154020035 CCCCGCGCCGGGGAGGGCCCGGG + Intergenic
1200292469 X:154886283-154886305 CAGCCCGCCGAGGGGGACGCAGG + Intronic
1200292592 X:154886739-154886761 CACCGCGGCGCCCAGGGCGCTGG - Exonic
1200339313 X:155382023-155382045 CAGCCCGCCGAGGGGGACGCAGG + Intergenic
1200339436 X:155382479-155382501 CACCGCGGCGCCCAGGGCGCTGG - Exonic
1200347034 X:155458214-155458236 CACCGCGGCGCCCAGGGCGCTGG + Exonic
1200347157 X:155458670-155458692 CAGCCCGCCGAGGGGGACGCAGG - Exonic