ID: 1141959193

View in Genome Browser
Species Human (GRCh38)
Location 16:87392828-87392850
Sequence CGCCCGCAGCGCGCTTGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 42}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141959193_1141959204 12 Left 1141959193 16:87392828-87392850 CCCCCGCAAGCGCGCTGCGGGCG 0: 1
1: 0
2: 0
3: 1
4: 42
Right 1141959204 16:87392863-87392885 CTGGGGCCCAACAGCCCCCGGGG 0: 1
1: 0
2: 2
3: 28
4: 222
1141959193_1141959213 30 Left 1141959193 16:87392828-87392850 CCCCCGCAAGCGCGCTGCGGGCG 0: 1
1: 0
2: 0
3: 1
4: 42
Right 1141959213 16:87392881-87392903 CGGGGCCGCGCTGGGCCGTTCGG 0: 1
1: 0
2: 0
3: 10
4: 128
1141959193_1141959203 11 Left 1141959193 16:87392828-87392850 CCCCCGCAAGCGCGCTGCGGGCG 0: 1
1: 0
2: 0
3: 1
4: 42
Right 1141959203 16:87392862-87392884 TCTGGGGCCCAACAGCCCCCGGG 0: 1
1: 0
2: 3
3: 25
4: 264
1141959193_1141959208 22 Left 1141959193 16:87392828-87392850 CCCCCGCAAGCGCGCTGCGGGCG 0: 1
1: 0
2: 0
3: 1
4: 42
Right 1141959208 16:87392873-87392895 ACAGCCCCCGGGGCCGCGCTGGG 0: 1
1: 0
2: 0
3: 9
4: 176
1141959193_1141959202 10 Left 1141959193 16:87392828-87392850 CCCCCGCAAGCGCGCTGCGGGCG 0: 1
1: 0
2: 0
3: 1
4: 42
Right 1141959202 16:87392861-87392883 TTCTGGGGCCCAACAGCCCCCGG 0: 1
1: 0
2: 2
3: 24
4: 274
1141959193_1141959200 -6 Left 1141959193 16:87392828-87392850 CCCCCGCAAGCGCGCTGCGGGCG 0: 1
1: 0
2: 0
3: 1
4: 42
Right 1141959200 16:87392845-87392867 CGGGCGAGGGTCGCGCTTCTGGG 0: 1
1: 0
2: 0
3: 3
4: 26
1141959193_1141959207 21 Left 1141959193 16:87392828-87392850 CCCCCGCAAGCGCGCTGCGGGCG 0: 1
1: 0
2: 0
3: 1
4: 42
Right 1141959207 16:87392872-87392894 AACAGCCCCCGGGGCCGCGCTGG 0: 1
1: 0
2: 1
3: 6
4: 140
1141959193_1141959201 -5 Left 1141959193 16:87392828-87392850 CCCCCGCAAGCGCGCTGCGGGCG 0: 1
1: 0
2: 0
3: 1
4: 42
Right 1141959201 16:87392846-87392868 GGGCGAGGGTCGCGCTTCTGGGG 0: 1
1: 0
2: 0
3: 2
4: 76
1141959193_1141959199 -7 Left 1141959193 16:87392828-87392850 CCCCCGCAAGCGCGCTGCGGGCG 0: 1
1: 0
2: 0
3: 1
4: 42
Right 1141959199 16:87392844-87392866 GCGGGCGAGGGTCGCGCTTCTGG 0: 1
1: 0
2: 0
3: 2
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141959193 Original CRISPR CGCCCGCAGCGCGCTTGCGG GGG (reversed) Intronic
916773435 1:167936152-167936174 TGCTGGCAGCGCGCTTGCGCAGG + Intronic
917141638 1:171841465-171841487 GACCCGCAGCGCGCCTGCGCGGG - Intergenic
923198973 1:231693844-231693866 CACCTGCAGCGTGCTTTCGGAGG + Exonic
923490260 1:234478338-234478360 CGCCCGCGGCGCGCGCGAGGCGG - Exonic
1067362480 10:45594969-45594991 CGACTGCAGCGCGCTGGGGGCGG + Intergenic
1072757698 10:98031315-98031337 CGCCCGCTCCCCGCCTGCGGGGG - Intergenic
1079237174 11:18699100-18699122 CGCCCCCAGCCCGCCCGCGGAGG + Intronic
1090190300 11:124762410-124762432 CGCCCCCAGCGCGCGGACGGCGG + Intergenic
1092871952 12:12813258-12813280 CGCCCCCTGCGGGCTTGCCGGGG - Intronic
1094238051 12:28190744-28190766 CGCCTGCAGCCCGCCTGCTGCGG + Intronic
1096154916 12:49336495-49336517 CGCCCGCCACCCTCTTGCGGCGG + Exonic
1103954133 12:124567246-124567268 GGCGCGGAGCGCGCTTCCGGGGG - Intronic
1125520146 15:40343917-40343939 GGCCCGCAGAGCACTTGCTGGGG + Intergenic
1132365169 15:101251696-101251718 TGCCCGGCGCGCGCTAGCGGCGG + Exonic
1137328073 16:47461338-47461360 CGACCGGAGCGCGATGGCGGGGG + Exonic
1141959193 16:87392828-87392850 CGCCCGCAGCGCGCTTGCGGGGG - Intronic
1142374878 16:89701678-89701700 CGCGCGCCGCGCGCTTCCGCCGG + Exonic
1151543325 17:74776481-74776503 CTTCCGCAGCGCGCATGCGCCGG - Exonic
1153489292 18:5630636-5630658 CGCCCGAAGCGCGCTGCAGGTGG - Intronic
1155507830 18:26549171-26549193 CGCCCGCTGCGCCCTGGCCGCGG - Exonic
1163547316 19:17948074-17948096 CGCGCCCAGCGCGCATGCGTCGG + Intergenic
1165510966 19:36266510-36266532 CGGCGGTGGCGCGCTTGCGGCGG - Intergenic
1166959568 19:46489473-46489495 CTCCCGCAGGGAGCATGCGGTGG - Intronic
925165664 2:1714224-1714246 CACCCGCAGCACCCTTGCGTAGG + Intronic
1174386420 20:50190650-50190672 CACCCGGAGCGCGTTTTCGGGGG - Intergenic
1178351137 21:31873661-31873683 CGCCGGCATCGCGCTCGCCGCGG - Exonic
1179794651 21:43776040-43776062 CGCGCGCAGCGCCCGAGCGGAGG + Intronic
1184663773 22:45977167-45977189 CGCTCGCGGCTCGCTTGCCGGGG - Intergenic
1185250532 22:49799404-49799426 CCCCCGCCGCCAGCTTGCGGAGG - Intronic
954633160 3:52057618-52057640 CGCAGGCGGCGCGCTTGCGTAGG + Intergenic
954823008 3:53347667-53347689 CGCCCGGAGCGTGCGCGCGGCGG - Intergenic
975870650 4:78775985-78776007 CGCGGGCAGCGCGCCTGCGCGGG + Intergenic
979523840 4:121697098-121697120 CGGCCTCAGCGCGCCTGCGTGGG + Exonic
983254148 4:165379316-165379338 CGCCCGCGGCGGGCATGAGGCGG + Exonic
986297099 5:6448770-6448792 CGCCCGCTGCCCTCTCGCGGGGG - Exonic
1007585088 6:42984565-42984587 CGGGCGCAGCGCGCAGGCGGTGG + Exonic
1017497572 6:154995341-154995363 CGCGCGCTGTGCGCCTGCGGCGG - Intronic
1046871237 8:119208160-119208182 CGCCCGCGGAGCGCTGGCGCTGG + Intronic
1049109834 8:140635738-140635760 CGGCGGGAGCGCGCTCGCGGGGG + Intergenic
1056992476 9:91424143-91424165 CGACCGGAGCGAGCCTGCGGAGG + Intergenic
1058662867 9:107282831-107282853 CACCCGCGGGGCGCTTGCTGCGG - Intergenic
1060551002 9:124485428-124485450 CGCCCCCAGCGCGCCTGCTGAGG + Intronic
1062431261 9:136527798-136527820 CGCCCGCCGCTCACCTGCGGGGG - Intronic
1062432198 9:136531234-136531256 CGCCCCCAGGGCGGTTGTGGGGG - Intronic