ID: 1141959431

View in Genome Browser
Species Human (GRCh38)
Location 16:87394569-87394591
Sequence TGTAGCTAAAGAAACTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 178}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141959431 Original CRISPR TGTAGCTAAAGAAACTGGGT GGG Intronic
904258611 1:29273697-29273719 TATAAATAAAGAAACTGGGCTGG - Intronic
905236066 1:36549396-36549418 TCTATCTTAAGAAACTGGGTGGG - Intergenic
906990564 1:50733046-50733068 TGCAGATAGAGAAACTGAGTTGG - Intronic
908219681 1:61992436-61992458 TGAATCTAAACAAATTGGGTTGG - Intronic
910439385 1:87237123-87237145 TGTTGCTAATGAGACTTGGTTGG - Intergenic
912534538 1:110355983-110356005 TGTTTCTATAGAAACTGGGTTGG + Intergenic
914238044 1:145830493-145830515 TGTAGCTTAAGAAATCGGGTTGG + Intronic
916911388 1:169350900-169350922 TATAGCTAAAGAAACTAGTTGGG - Intronic
918543625 1:185658267-185658289 TGTGGCATAAGAAACTGAGTAGG - Intergenic
920709624 1:208282616-208282638 TGTAGATAAAGAAACTGGGCTGG - Intergenic
922301428 1:224304620-224304642 TGTAGAAAAGGAAACTGGGAAGG - Intronic
922417283 1:225433070-225433092 TATAGCTGAAGAAACTGAGGAGG + Intergenic
923394509 1:233547903-233547925 TGTGGATACAGAAAGTGGGTAGG - Intergenic
1063531859 10:6840671-6840693 TGTATTTGAAGAAACTGGGGAGG - Intergenic
1068197310 10:53733492-53733514 GGTAGCTAAAGTAATTGGTTAGG - Intergenic
1069323928 10:67207503-67207525 TGTAGCTTAAGAACCTCTGTGGG + Intronic
1070015486 10:72525581-72525603 TATAGCTAATTAAACTGGGAAGG + Intronic
1073320161 10:102611197-102611219 AGTAGAAAAAGAAACTTGGTGGG + Intronic
1077512298 11:2974427-2974449 TCTCGCTTTAGAAACTGGGTTGG - Intronic
1078448765 11:11424820-11424842 TGGAGCTAAGCAAAGTGGGTGGG + Intronic
1079905709 11:26244347-26244369 TGTAGCTAACACAACTGGATGGG + Intergenic
1080461500 11:32458777-32458799 TGTAGCAAAAGCAAATGGGCTGG + Intergenic
1080698189 11:34621202-34621224 TTTACCTAAAGATTCTGGGTGGG - Intronic
1082839693 11:57678921-57678943 TGTAGCTGAAGTAACAAGGTTGG + Intronic
1083744325 11:64726813-64726835 TGTAGCCAGAGAAACTTGGGAGG - Intergenic
1085234083 11:74998563-74998585 TGTAGGTAAAAAAGCAGGGTAGG - Intronic
1087227243 11:95614944-95614966 AGTAGTTACAGAAACTGGATTGG - Intergenic
1089216932 11:116839976-116839998 TGTAGCTTTAGAAAGTGGGAAGG + Intergenic
1090836931 11:130460900-130460922 TGTAGCCAATGAAACTGTGCCGG + Intronic
1090952773 11:131488075-131488097 TGTAGGTATAGAGTCTGGGTAGG - Intronic
1094188594 12:27672608-27672630 TGTAGCTATAATAATTGGGTGGG + Intronic
1094333353 12:29320642-29320664 TGTAGCTAAAAGACCTAGGTTGG + Intronic
1096147896 12:49292002-49292024 TGTGGATAAAGAAAATGGGGTGG + Intergenic
1096578494 12:52569611-52569633 TGCAGATAAAGCAACTGGGCTGG - Intronic
1096859077 12:54510130-54510152 TGTAGCTAAAAAATCATGGTTGG + Intronic
1097266566 12:57749079-57749101 TGTGGTTAATGAAACTTGGTTGG - Intronic
1098000840 12:65940706-65940728 TGGAGCTATACAACCTGGGTGGG + Intronic
1098127729 12:67317776-67317798 TATAGATTAAGAAACTGGCTGGG - Exonic
1098818044 12:75193348-75193370 TATAGGTAAAGAAAAGGGGTTGG + Intronic
1100450814 12:94704719-94704741 TCTAGCTAAAGAAAAAGGGCTGG + Intergenic
1100456195 12:94753931-94753953 TGCAGCTGAAGAGACTGGTTGGG + Intergenic
1104011065 12:124930366-124930388 TGTTGCTAAAGAAATTGAGAAGG + Intergenic
1106472744 13:30072167-30072189 TGTGGGTCAAGAGACTGGGTGGG - Intergenic
1107755241 13:43614643-43614665 TGTAGGTGTAGAAACTGGATTGG - Intronic
1109504869 13:63287083-63287105 TGTAGCTAAAGCAGGTGGATAGG + Intergenic
1111864891 13:93756320-93756342 TGTAGTGTAAGAAAATGGGTGGG - Intronic
1112298684 13:98211027-98211049 TATAACTAAAGAAAGAGGGTTGG - Intronic
1112999489 13:105617503-105617525 GGTCACTGAAGAAACTGGGTCGG - Intergenic
1113572226 13:111366212-111366234 TGTAGCTGCTGAAACTGGCTCGG - Intergenic
1114656493 14:24318910-24318932 TGTAGCTTAAGAAAAAGAGTGGG + Intronic
1115100942 14:29698845-29698867 TGAAGTAAAAGAAACTGTGTTGG + Intronic
1115199898 14:30841651-30841673 TGTACATTAAGAAGCTGGGTGGG - Intergenic
1120289394 14:82547627-82547649 TGTGACTACAGAAACTGGGGGGG - Intergenic
1122026871 14:98884524-98884546 TGCAGCTAAAGAGACTGAGATGG + Intergenic
1124687109 15:31792068-31792090 TTTGGCTTAAGAAACTTGGTGGG - Intronic
1128058074 15:64715503-64715525 TTTAGTTAAAAAAACTGGCTGGG - Intergenic
1129242443 15:74259545-74259567 TGCAGATAAAGCAACTGGGTGGG - Intronic
1129783257 15:78288838-78288860 GGTAGCTAAAGAACAGGGGTAGG - Intronic
1129985380 15:79915377-79915399 TGTAGGAAAAAAAAGTGGGTGGG - Intronic
1133419383 16:5632868-5632890 TGTGGCTAAGAAAACTGGGCTGG + Intergenic
1134157080 16:11852373-11852395 TGTCGCTAAACAAACAGGTTAGG + Intergenic
1135294725 16:21269409-21269431 TATGGATCAAGAAACTGGGTGGG - Intronic
1138314199 16:56054409-56054431 TGTAAGTAAAGAAACTAGTTTGG + Intergenic
1138616967 16:58176353-58176375 TGTAGCTAGAAATACTGTGTTGG - Intronic
1141719312 16:85746882-85746904 TCCAGCCAAAGGAACTGGGTTGG + Intronic
1141959431 16:87394569-87394591 TGTAGCTAAAGAAACTGGGTGGG + Intronic
1142718755 17:1762700-1762722 CGTAGCCAAAGAGAGTGGGTGGG - Intronic
1148942781 17:51229267-51229289 TGTAGCAAAAGAAAAAGGATAGG - Intronic
1149100511 17:52900847-52900869 TATAGCTAAAGAAAGTGGGCAGG + Intergenic
1149259562 17:54864153-54864175 TGGAGTTAAAGACACTGGGAGGG + Intergenic
1152466345 17:80468724-80468746 TGTAGCTACTGAAAATGGCTGGG - Exonic
1156009522 18:32480410-32480432 TGTAGGAAAAGAACCTGTGTGGG - Intergenic
1156103068 18:33621884-33621906 TGTAAATAAAGAAACAGAGTGGG - Intronic
1156847528 18:41684483-41684505 TATAGCTTAAAAAAGTGGGTTGG + Intergenic
1157098451 18:44708534-44708556 TGTAGCTAAAGCAGCAGGGAAGG + Intronic
1158657163 18:59348334-59348356 AGTAACTTAAGAAACTGTGTTGG + Intronic
1159107955 18:64025586-64025608 TGTAGGAAAAGAAATTGGGAAGG + Intergenic
1159491207 18:69136996-69137018 TATAGCTAAAGAAAATGTTTTGG + Intergenic
1161450412 19:4342673-4342695 TGTAGTTGCAGAAACAGGGTAGG + Intronic
1165270802 19:34706023-34706045 AGTAGGTAAACAAAGTGGGTGGG - Intergenic
1165306110 19:35003929-35003951 TGTTACTAAAGAAATTGGTTGGG + Intronic
1165664798 19:37619084-37619106 TATAGCTAAAGAAACAGGAAAGG + Intronic
1166703812 19:44897212-44897234 TGTGGGTAGAGAAACTGGGGGGG + Intronic
925507939 2:4589995-4590017 TGTAGCTTAAGAAAATGGTGTGG - Intergenic
926002985 2:9349032-9349054 TGTAGCTAAAGACACTGGCCCGG - Intronic
926757465 2:16247760-16247782 TGGAGGTGGAGAAACTGGGTGGG + Intergenic
927746021 2:25622004-25622026 TGTATCTAATGAAACTAGTTTGG - Intronic
930334254 2:50025524-50025546 AGTAGCTAAAGAAATTGAGGTGG + Intronic
930397050 2:50835374-50835396 TGTTGGAAAAGCAACTGGGTAGG - Intronic
930855658 2:56014623-56014645 TGTAGCTAAAATAAATGGTTTGG + Intergenic
930915982 2:56688796-56688818 TCTAGCTAGAGGAATTGGGTAGG + Intergenic
932004498 2:67914831-67914853 TGTGGCTAAAGGGAGTGGGTAGG - Intergenic
932264671 2:70357451-70357473 TCTAGATTAAGAAACTGGGATGG + Intergenic
939853978 2:147334632-147334654 TATAAATAAAGAAAATGGGTGGG + Intergenic
939882392 2:147645252-147645274 AGAAACTAAAGAAAATGGGTGGG - Intergenic
939897360 2:147808334-147808356 TTTAGCTTAAGAAACTGGAGTGG - Intergenic
941985501 2:171507074-171507096 TGTAGCCAAAGATGCTAGGTTGG + Intergenic
942471261 2:176263006-176263028 TGTATATAAAAAAACTGGATGGG - Intergenic
942990259 2:182192150-182192172 TTTAGCTCAAGAAAGTGGCTGGG - Intronic
944644541 2:201765321-201765343 TTAAGCTAATGAAACTGGCTGGG - Intronic
946096692 2:217280775-217280797 TTGAGATAAAGAAAATGGGTAGG + Intergenic
946207943 2:218124340-218124362 TGTAGCTAAAGTAGGTGGGTAGG + Intergenic
946224221 2:218254295-218254317 TGTATCTAAAGAAATACGGTTGG + Exonic
947553107 2:231061876-231061898 TGTTGATAATGAAACTGGGGCGG - Intronic
1169405654 20:5318823-5318845 TGAACCCAGAGAAACTGGGTGGG + Intergenic
1169671241 20:8105500-8105522 TGCAGCTATAGAGAATGGGTAGG + Intergenic
1172665276 20:36594882-36594904 CCTAGGTAAAGAAACTGAGTGGG + Intronic
1173555682 20:43963883-43963905 TGTAGATGAAGAAACTGAGTGGG - Intronic
1176178732 20:63740065-63740087 TGCAGCGAGAGAAACTTGGTCGG - Intronic
1176669431 21:9718566-9718588 TGTAGCTACTGAAAATGAGTTGG + Intergenic
1177745846 21:25212254-25212276 TTTAGACAAAGAAACTGGCTTGG - Intergenic
1183293205 22:37015358-37015380 AGTCGATAAAGAAACTGGGCTGG + Intronic
949783333 3:7714106-7714128 TCTAGTGAAAGAAACTGGGATGG + Intronic
950459043 3:13110292-13110314 TGTAGTTAAAGAAACCCGGCCGG + Intergenic
952787786 3:37173074-37173096 TGTAGTCAAAGCTACTGGGTAGG + Intronic
956004169 3:64761303-64761325 TGTGGATGAAGAAACTGGGAAGG - Intergenic
958014276 3:87919988-87920010 AGTGGATAAAGAAACTGTGTGGG + Intergenic
958097205 3:88961882-88961904 TGAATTTAAAGAAACTAGGTGGG + Intergenic
959786245 3:110302163-110302185 TGTAGCCAAAGATGCTGGATTGG + Intergenic
962507433 3:136062017-136062039 TGTAGATAAAGAGACTAGGATGG + Intronic
963825165 3:149945397-149945419 TGTAGGTAAACAAAGTGGTTAGG + Intronic
963949056 3:151178540-151178562 TGTGTCAAAAGAACCTGGGTAGG - Intronic
965415929 3:168392085-168392107 AGTGGATAAAGAAACTGTGTGGG - Intergenic
966022940 3:175238036-175238058 TTTTGCTAATGAAACTGGGTGGG + Intronic
968134253 3:196209888-196209910 GGTGGCTTAAGAAACGGGGTAGG + Intronic
970366241 4:15361279-15361301 TATAGGTTAAGAAACTGGCTTGG + Intronic
974781357 4:66557678-66557700 TGTACATAAAGAAATTGGTTTGG - Intergenic
976705716 4:88016837-88016859 TGTAGTTTAAGAAACTTGGGAGG + Intronic
977796779 4:101175186-101175208 TGAAGCTATAGAAACTGGAAGGG + Intronic
978032112 4:103947831-103947853 ACTAGGTAAAGAAACTGGTTTGG + Intergenic
978373938 4:108055898-108055920 TGTTAATAAAGAAATTGGGTTGG - Intronic
978434245 4:108666256-108666278 TTTATGTAAAGAAACTGGTTTGG - Intronic
978698731 4:111616559-111616581 TGGGGCTAAAGAAACTGAGATGG - Intergenic
979424383 4:120547760-120547782 CCTAGCCAAAGAAAATGGGTTGG - Intergenic
985405340 4:189632903-189632925 TGTAGCTACTGAAAATGAGTTGG - Intergenic
985608256 5:870838-870860 TGGGGCTAAAGAAATTGGGGAGG + Intronic
985664444 5:1174694-1174716 TCTAGCTTAAGACTCTGGGTGGG - Intergenic
986950450 5:13077116-13077138 TATAGCCAAAGATACTGGTTAGG + Intergenic
988418153 5:30972249-30972271 CTTAGCTAAAGAAATTGGGTTGG - Intergenic
989189595 5:38657612-38657634 AGTAGCTAAAGAAATAGGATTGG + Intergenic
989209443 5:38845410-38845432 TGTAGCCGAAGAAACTTTGTCGG + Intergenic
989522454 5:42418091-42418113 AGTAGGTAAAGAAAGTGGCTGGG - Intergenic
990621488 5:57564386-57564408 ACTAGCTAAAGAAAATGGTTGGG + Intergenic
990950191 5:61291107-61291129 TGGAGCTACAGGAAGTGGGTGGG - Intergenic
991390771 5:66141373-66141395 TAGAGGCAAAGAAACTGGGTAGG - Intronic
994572226 5:101529356-101529378 AGTAGGTAAACAAAGTGGGTGGG + Intergenic
995757978 5:115531477-115531499 TGAAGCTAAAGAGATAGGGTAGG - Intronic
997792600 5:136774427-136774449 TGTGGCTAATGAAATTGGATAGG - Intergenic
998407571 5:141882774-141882796 TGTTTCCATAGAAACTGGGTAGG + Intergenic
1000255218 5:159531162-159531184 TTTTGGAAAAGAAACTGGGTGGG + Intergenic
1000782700 5:165503067-165503089 TGTAGATGAGGAAACTGGGCAGG + Intergenic
1006767403 6:36519957-36519979 TTTTACTAAATAAACTGGGTAGG - Intronic
1013026272 6:106276166-106276188 TATAGATTAAGAAACTGGGCCGG + Intronic
1014937555 6:127401637-127401659 TGTAGCTCAAGAACCTGCATAGG - Intergenic
1015872602 6:137792360-137792382 TCTAGATAGAGAAACTGGGTGGG + Intergenic
1016756968 6:147697877-147697899 TTTAGCTAAAAAAACTATGTAGG + Intronic
1018332662 6:162748129-162748151 TGTCATTAAAGAAAGTGGGTTGG + Intronic
1021089803 7:16470272-16470294 TGTAGATGAAGAAACTGACTAGG - Intronic
1021530052 7:21634118-21634140 TTTAGGAAAAGAAACTGGTTTGG + Intronic
1022588106 7:31634949-31634971 GCTAGCTGAAGGAACTGGGTGGG + Intronic
1026552529 7:71380614-71380636 TTTAAGTAAAAAAACTGGGTTGG - Intronic
1027702094 7:81481921-81481943 TGGTGCTAAAGAAATTGTGTTGG - Intergenic
1028127309 7:87128336-87128358 TGACACTGAAGAAACTGGGTGGG + Intergenic
1028956354 7:96697640-96697662 TGTATTTGAAGAAACTTGGTTGG - Intronic
1030776860 7:113544252-113544274 TCTAGCAAAAGACACTGGGAAGG - Intergenic
1031021770 7:116636253-116636275 TTTATATAAAGAAATTGGGTAGG - Intergenic
1031078962 7:117240128-117240150 TCCAGCTAAAGAGACTGGGTAGG - Intergenic
1031585568 7:123528999-123529021 TGTAGCTTTCCAAACTGGGTTGG - Intronic
1032154116 7:129454312-129454334 TGTAGCTAATCTCACTGGGTTGG + Intronic
1033783651 7:144703400-144703422 TGAAACTAATGAAACTGGTTAGG + Intronic
1035612913 8:980223-980245 TGTAGCCAAAGAAACGGGATGGG + Intergenic
1035895663 8:3397708-3397730 TGTTACTAAAGAAACAGGATAGG - Intronic
1037561911 8:20082995-20083017 AGAAGCCAAAGAAACAGGGTTGG + Intergenic
1041046337 8:53890484-53890506 TGTATATAAAGAAACTGTGTAGG + Intronic
1043387258 8:79760482-79760504 AGTAGCTACAGAAACTGTTTGGG + Intergenic
1046698281 8:117369003-117369025 TGTAGCATAAGAAACAGGCTTGG - Intergenic
1047136786 8:122088242-122088264 TGAGGCTAAAGAAGCTGGGTTGG + Intergenic
1047289270 8:123515056-123515078 TATAGATGAACAAACTGGGTGGG - Intronic
1048959052 8:139560830-139560852 TGTAGGGACAGAAAGTGGGTTGG + Intergenic
1050056310 9:1659366-1659388 TATAGCTAAAGAATTTGGTTTGG + Intergenic
1050309554 9:4339274-4339296 TGTAGCTAAAGCCAGTGGGAGGG + Intronic
1051156828 9:14157402-14157424 TGTTTCTAAAGAAGGTGGGTGGG - Intronic
1052993699 9:34538004-34538026 TGTATATAAAGAAACTGGCGTGG - Intergenic
1053310586 9:37016158-37016180 TGTAGTTCAAGAGGCTGGGTGGG - Intronic
1058303684 9:103408845-103408867 GGAAGCTAAACAAACTGGTTGGG + Intergenic
1059797209 9:117711264-117711286 AGAAGCTAAATAAAATGGGTGGG + Intronic
1060251318 9:121988553-121988575 TGAAGCAGGAGAAACTGGGTAGG - Intronic
1203656436 Un_KI270753v1:2370-2392 TGTAGCTACTGAAAATGAGTTGG - Intergenic
1188086825 X:25909129-25909151 TATGGCAAAAGAAACTGGGGAGG - Intergenic
1188102884 X:26112373-26112395 TCTAGCAAAAGAATGTGGGTAGG - Intergenic
1188871642 X:35381026-35381048 TGTAGCAAAAGCAGATGGGTAGG + Intergenic
1196169568 X:112572971-112572993 TTTAGTTAAAGATACTGGTTTGG - Intergenic
1198691346 X:139288185-139288207 TGTAGCTCCAGAAACTTGGGAGG + Intergenic
1199479341 X:148280750-148280772 TGAAGAAAAAAAAACTGGGTAGG - Intergenic
1199569923 X:149257028-149257050 TGTAGGAAAAGAAACAGGGCTGG + Intergenic
1201748226 Y:17403861-17403883 TATGGCAAAAGAATCTGGGTTGG - Intergenic