ID: 1141960829 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:87406897-87406919 |
| Sequence | GTCGCACAGGACTCTCCTCT GGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 65 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 1, 4: 62} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1141960822_1141960829 | -9 | Left | 1141960822 | 16:87406883-87406905 | CCACCCCCGCTCAGGTCGCACAG | 0: 1 1: 0 2: 0 3: 4 4: 111 |
||
| Right | 1141960829 | 16:87406897-87406919 | GTCGCACAGGACTCTCCTCTGGG | 0: 1 1: 0 2: 1 3: 1 4: 62 |
||||
| 1141960820_1141960829 | 12 | Left | 1141960820 | 16:87406862-87406884 | CCTGCATGCTGGAAATGGCAGCC | 0: 1 1: 0 2: 1 3: 12 4: 164 |
||
| Right | 1141960829 | 16:87406897-87406919 | GTCGCACAGGACTCTCCTCTGGG | 0: 1 1: 0 2: 1 3: 1 4: 62 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1141960829 | Original CRISPR | GTCGCACAGGACTCTCCTCT GGG | Exonic | ||