ID: 1141960829

View in Genome Browser
Species Human (GRCh38)
Location 16:87406897-87406919
Sequence GTCGCACAGGACTCTCCTCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 62}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141960822_1141960829 -9 Left 1141960822 16:87406883-87406905 CCACCCCCGCTCAGGTCGCACAG 0: 1
1: 0
2: 0
3: 4
4: 111
Right 1141960829 16:87406897-87406919 GTCGCACAGGACTCTCCTCTGGG 0: 1
1: 0
2: 1
3: 1
4: 62
1141960820_1141960829 12 Left 1141960820 16:87406862-87406884 CCTGCATGCTGGAAATGGCAGCC 0: 1
1: 0
2: 1
3: 12
4: 164
Right 1141960829 16:87406897-87406919 GTCGCACAGGACTCTCCTCTGGG 0: 1
1: 0
2: 1
3: 1
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141960829 Original CRISPR GTCGCACAGGACTCTCCTCT GGG Exonic