ID: 1141961592

View in Genome Browser
Species Human (GRCh38)
Location 16:87412771-87412793
Sequence CACGGAATTCAGCATGCGGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 79}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141961589_1141961592 -6 Left 1141961589 16:87412754-87412776 CCTCTTTCCGGCTTGTGCACGGA 0: 1
1: 0
2: 0
3: 2
4: 32
Right 1141961592 16:87412771-87412793 CACGGAATTCAGCATGCGGATGG 0: 1
1: 0
2: 0
3: 1
4: 79
1141961587_1141961592 -5 Left 1141961587 16:87412753-87412775 CCCTCTTTCCGGCTTGTGCACGG 0: 1
1: 0
2: 0
3: 1
4: 50
Right 1141961592 16:87412771-87412793 CACGGAATTCAGCATGCGGATGG 0: 1
1: 0
2: 0
3: 1
4: 79
1141961586_1141961592 2 Left 1141961586 16:87412746-87412768 CCGCGCTCCCTCTTTCCGGCTTG 0: 1
1: 0
2: 0
3: 12
4: 227
Right 1141961592 16:87412771-87412793 CACGGAATTCAGCATGCGGATGG 0: 1
1: 0
2: 0
3: 1
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141961592 Original CRISPR CACGGAATTCAGCATGCGGA TGG Exonic
904468790 1:30723346-30723368 CACGGGATCCAGGATGGGGAAGG - Intronic
907080445 1:51617042-51617064 TATGGCATTCAGCATGCGGGGGG - Intronic
919972033 1:202587238-202587260 CAAGGAATTAAGAATGCAGAGGG - Exonic
920779830 1:208978405-208978427 CATGGAAGTCAGCATGCAGGAGG + Intergenic
921269086 1:213451141-213451163 CACTGAATTCAGAATCCGTAAGG + Intergenic
1080933253 11:36836320-36836342 CACAGAATTCAGAATATGGATGG - Intergenic
1081623965 11:44635620-44635642 CCCAGAATTCAGAATGCTGAAGG + Intergenic
1090142398 11:124278332-124278354 CATGGAATTCAGAATCTGGATGG + Intergenic
1091515270 12:1173870-1173892 CACTGAATTCAGCATCATGATGG - Intronic
1093343943 12:18016937-18016959 CACAGAATTCAGAATTTGGATGG + Intergenic
1096346459 12:50851227-50851249 CACAGAATTCAGAATCTGGATGG + Intronic
1099088456 12:78276918-78276940 CACAGAATTCAGAATATGGATGG - Intergenic
1101306420 12:103532238-103532260 CACGGTATCCATCATGCAGATGG - Intergenic
1102650779 12:114440872-114440894 CACGGAAAGCAGAAGGCGGAAGG + Intergenic
1106594541 13:31125238-31125260 GATGGGATTCAGCATGCTGATGG + Intergenic
1107335898 13:39354562-39354584 CACAGAATTCAGAATATGGATGG + Intronic
1109651881 13:65337429-65337451 CACAGAATTCAGAATCTGGATGG + Intergenic
1114491709 14:23106393-23106415 CAAGGACTTCAGGATGTGGAGGG - Intergenic
1114938440 14:27574126-27574148 CATGGAATTCAGAATCTGGATGG + Intergenic
1115124428 14:29974565-29974587 CCCTGAATACAGCATACGGATGG - Intronic
1117424666 14:55580965-55580987 CACGGAAAGCAGCATGAGGGGGG + Intronic
1119878726 14:78082504-78082526 CACGGAATTTAGAATTCAGAGGG + Intergenic
1120535664 14:85691958-85691980 CAAGGAATTCAGCATGAAGGAGG - Intergenic
1127753285 15:62067105-62067127 CAGGGAATTAAGCAAGCCGATGG - Intronic
1128028254 15:64457873-64457895 CAAGGCATCCAGCATGTGGAGGG + Intergenic
1131603155 15:93870732-93870754 CATGGAATTCAGCGGGCAGATGG + Intergenic
1131928109 15:97408451-97408473 CGTGGAATCCAGCATGCAGAAGG + Intergenic
1138729686 16:59181628-59181650 CACTGAATTCAGCATATGGATGG - Intergenic
1140577423 16:76187191-76187213 CATGGAATCCAGCATCTGGATGG + Intergenic
1140992891 16:80231600-80231622 GACAAAATTCAGCATGCTGAAGG + Intergenic
1141961592 16:87412771-87412793 CACGGAATTCAGCATGCGGATGG + Exonic
1157000351 18:43515315-43515337 AACGGAATTCAGAATGTAGATGG - Intergenic
1157053702 18:44199419-44199441 AACGGAATTCAGAATCCAGACGG + Intergenic
1159802323 18:72916880-72916902 CACAGAATTCAGAATCTGGATGG - Intergenic
1165489105 19:36113146-36113168 CACGGAATGCAGAGTGCAGACGG + Intronic
935729582 2:106054445-106054467 CATGGAGTTCACCATGCAGAGGG + Intergenic
943018452 2:182543971-182543993 GACAGAATTCAGGATGTGGAGGG - Intergenic
945658769 2:212658877-212658899 CACAGAATTCAGAATCTGGATGG - Intergenic
945758800 2:213884953-213884975 CAAGGAATTCAGAATCTGGATGG - Intronic
1173729174 20:45316833-45316855 CCCGGAATACAGCGTGCGGCCGG + Exonic
957254912 3:77824813-77824835 CATGGAATTCAGAATCTGGATGG - Intergenic
959494308 3:107031278-107031300 CATGGAATTCAGAATCTGGATGG + Intergenic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
965340543 3:167485436-167485458 CATAGAATTCAGCATCTGGATGG + Intronic
967810576 3:193757284-193757306 CACTGAAGTCTGCATGGGGATGG - Intergenic
969279458 4:6160507-6160529 CAGGGCATGCAGCATGCGGGAGG - Intronic
969294523 4:6262012-6262034 CAGGGAACTGAGCATGGGGAGGG - Intergenic
980322213 4:131293157-131293179 CACAGAATTCAGAATTTGGATGG - Intergenic
982380344 4:154742656-154742678 CACGGAACTCAGCACCCGGTGGG + Intronic
982600401 4:157442684-157442706 CACAGAATTCAGAATCTGGATGG - Intergenic
989151953 5:38308386-38308408 CCCAGCCTTCAGCATGCGGAGGG - Intronic
990357736 5:54986734-54986756 CATGGAATTCGGCATGTGGTTGG - Intronic
995243077 5:109907280-109907302 CACAGATTGCAGCATGGGGATGG - Intergenic
996142041 5:119923548-119923570 CATAGAATTCAGAATCCGGATGG - Intergenic
996410260 5:123151319-123151341 CCTGGATTTCAGCATGGGGAGGG - Intronic
997893484 5:137695488-137695510 CAAGGAAATCAGAATGCTGAAGG + Intronic
1006055547 6:31381880-31381902 CAGCTAATTCAGCATGGGGAAGG + Intergenic
1008420536 6:51294141-51294163 CATGGTATTCAGCAGGTGGATGG - Intergenic
1011093825 6:83636629-83636651 CACAGAATTCAGAATCTGGATGG - Intronic
1011584559 6:88910160-88910182 CACAGAATTCAGAATATGGATGG + Intronic
1013824764 6:114197965-114197987 CATGGAATTCAGAATCTGGATGG + Intronic
1014852619 6:126360884-126360906 CACAGAATTCAGAATCTGGATGG - Intergenic
1016663641 6:146610311-146610333 CATAGAATTCAGCATCTGGATGG - Intronic
1018145072 6:160878047-160878069 CATGGAATTCAGAATCTGGACGG + Intergenic
1019508257 7:1404474-1404496 CAAGAAAGTCAGCAGGCGGAAGG + Intergenic
1023725892 7:43142399-43142421 CACAGAATCTAGCATGCTGAAGG + Intronic
1027641407 7:80737800-80737822 GAAGGAATTCAGCTTGAGGAAGG + Intergenic
1035646064 8:1222051-1222073 CATGGAATTCAGAATCTGGATGG - Intergenic
1040623918 8:49123247-49123269 CCCTGAATTCAGCATGAAGATGG - Intergenic
1045879530 8:107021346-107021368 CATAGAATTCAGCATCTGGATGG + Intergenic
1046454663 8:114441783-114441805 CACAGAATTCAGAATTCGAATGG + Intergenic
1050684215 9:8148475-8148497 CACAGAATTCAGAATCTGGATGG + Intergenic
1051102225 9:13534825-13534847 CACAGAATGCAGAATACGGAAGG - Intergenic
1060983025 9:127804289-127804311 CAGGGTATTGAGCATGCGCACGG - Exonic
1192918019 X:75674475-75674497 CATGGAATTCAGAATGTGGCTGG + Intergenic
1193423032 X:81307721-81307743 CACAGAATTCAGCCTCTGGATGG - Intergenic
1194349367 X:92807662-92807684 CACAGAATTCAGAATATGGATGG - Intergenic
1195931175 X:110078422-110078444 CACAGAATTCAGAATCTGGATGG - Intronic
1198277661 X:135111952-135111974 CATGGAATTCAGTATCTGGATGG - Intergenic
1198586467 X:138127887-138127909 CACAGAATTCAGAATCTGGATGG - Intergenic
1200657693 Y:5924264-5924286 CACAGAATTCAGAATATGGATGG - Intergenic