ID: 1141961756

View in Genome Browser
Species Human (GRCh38)
Location 16:87413609-87413631
Sequence TTTCTATTGTGAAGAAAACC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 286}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141961751_1141961756 2 Left 1141961751 16:87413584-87413606 CCCTCCTGAGCTACTGCTCCTCC 0: 1
1: 1
2: 4
3: 27
4: 332
Right 1141961756 16:87413609-87413631 TTTCTATTGTGAAGAAAACCCGG 0: 1
1: 0
2: 2
3: 19
4: 286
1141961750_1141961756 18 Left 1141961750 16:87413568-87413590 CCAGGTTTTTTTTTTTCCCTCCT 0: 1
1: 2
2: 15
3: 231
4: 1977
Right 1141961756 16:87413609-87413631 TTTCTATTGTGAAGAAAACCCGG 0: 1
1: 0
2: 2
3: 19
4: 286
1141961749_1141961756 22 Left 1141961749 16:87413564-87413586 CCTGCCAGGTTTTTTTTTTTCCC 0: 1
1: 2
2: 17
3: 184
4: 1633
Right 1141961756 16:87413609-87413631 TTTCTATTGTGAAGAAAACCCGG 0: 1
1: 0
2: 2
3: 19
4: 286
1141961753_1141961756 -2 Left 1141961753 16:87413588-87413610 CCTGAGCTACTGCTCCTCCGATT No data
Right 1141961756 16:87413609-87413631 TTTCTATTGTGAAGAAAACCCGG 0: 1
1: 0
2: 2
3: 19
4: 286
1141961752_1141961756 1 Left 1141961752 16:87413585-87413607 CCTCCTGAGCTACTGCTCCTCCG 0: 1
1: 0
2: 0
3: 17
4: 162
Right 1141961756 16:87413609-87413631 TTTCTATTGTGAAGAAAACCCGG 0: 1
1: 0
2: 2
3: 19
4: 286
1141961748_1141961756 26 Left 1141961748 16:87413560-87413582 CCATCCTGCCAGGTTTTTTTTTT No data
Right 1141961756 16:87413609-87413631 TTTCTATTGTGAAGAAAACCCGG 0: 1
1: 0
2: 2
3: 19
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141961756 Original CRISPR TTTCTATTGTGAAGAAAACC CGG Intronic
901095469 1:6675767-6675789 TTTCTAATGGGAAGATAATCTGG + Intronic
901334027 1:8433236-8433258 GTTCCATTGTTAAGAGAACCAGG - Intronic
903355111 1:22741662-22741684 TTTTTGCTGGGAAGAAAACCAGG - Intronic
903983909 1:27210778-27210800 TTTCTTCTTTGAAGAACACCTGG - Intergenic
904959994 1:34324915-34324937 TGGCTTTTGTGAGGAAAACCAGG - Intergenic
905512326 1:38531340-38531362 TTGTTATTGTGAAGAAGACTAGG + Intergenic
905925435 1:41746302-41746324 TTTCTAATCTGAAGCAAACGGGG - Intronic
907894195 1:58668983-58669005 TTTTTTTAGTGAAGAAAAGCAGG - Exonic
908065659 1:60401358-60401380 TTTCTCTTTTGAAGAACACGAGG - Intergenic
908945051 1:69485682-69485704 TTTCTAGTTTGAAGAAAATAAGG - Intergenic
909103279 1:71377860-71377882 TTTCCATTGTCAAGAAAGGCTGG - Intergenic
909852758 1:80489360-80489382 TTTCTTTTCTGAAGAAATCCAGG + Intergenic
911341863 1:96649119-96649141 TTTTTAGTGGGAAGAAAACTTGG - Intergenic
911782970 1:101907112-101907134 TTGCTATTGTAATGGAAACCTGG - Intronic
912026264 1:105178208-105178230 TTTCTTTTGGGAAGATACCCAGG - Intergenic
912046215 1:105461703-105461725 TTTCTGTTGTGAACTAAACATGG - Intergenic
914295574 1:146319798-146319820 TGTCTCTTATAAAGAAAACCAGG + Intergenic
915388424 1:155518390-155518412 TTTCAATTTTGATGAAAACCAGG - Intronic
917389037 1:174512434-174512456 TTCCTATTTTGAAGTAAAACAGG - Intronic
917898941 1:179521679-179521701 TTTCTTTAGTGAAGATATCCTGG + Intronic
921130547 1:212215906-212215928 TTTTTAAAGTAAAGAAAACCTGG + Intergenic
923005906 1:230049575-230049597 ATTCTCTTGTGAATAACACCAGG - Intergenic
1064810046 10:19186558-19186580 ATTCTATTGAGAATAAAAGCAGG + Intronic
1064931425 10:20632446-20632468 TTTCTATTCTGAAGAAGGCCAGG - Intergenic
1065456951 10:25916885-25916907 TTCCTATTGCTAAGGAAACCTGG + Intergenic
1065648944 10:27866982-27867004 TTTTTTTTCTCAAGAAAACCGGG + Intronic
1066028654 10:31393629-31393651 TTTTTAATGTCACGAAAACCAGG - Intronic
1066287974 10:33987207-33987229 TGTCTATTTTAAAGAAAGCCAGG - Intergenic
1066306251 10:34144907-34144929 CTTCTGCTGTGCAGAAAACCAGG - Intronic
1068072488 10:52213278-52213300 GTTCAAATGTGAAGAAAATCAGG + Intronic
1069068233 10:63968218-63968240 TTTCTATCATGAAGAAATGCTGG - Intergenic
1069768516 10:70882205-70882227 TCTCTCTTGTGGAGTAAACCAGG + Intergenic
1070318704 10:75338093-75338115 TTTCTATTCTTAAGAAACACTGG - Intergenic
1070441300 10:76446712-76446734 TTTTTCTTGAGATGAAAACCTGG - Intronic
1070495895 10:77022005-77022027 TTTATATTTTGAAGAAGACGGGG - Intronic
1072993403 10:100220817-100220839 TTTTTTCTGTGAAGAAAACCTGG - Intronic
1074734407 10:116413779-116413801 ATTGTATTGAGAAGAAAACTGGG - Intergenic
1075471782 10:122696503-122696525 TTCATATTTTGAAGCAAACCTGG + Intergenic
1079194465 11:18313613-18313635 TTTTTATTTTTAAGAAATCCAGG + Intronic
1079656785 11:22994921-22994943 TTTCCAGTCTGAAGAGAACCAGG + Intergenic
1081815986 11:45942219-45942241 TTTCAATTTTTAAAAAAACCTGG + Intronic
1086807219 11:91259148-91259170 TTTCTATTCTGAAGGATAGCAGG + Intergenic
1087488215 11:98786383-98786405 TTTCTACTGTCAAGAAAAACCGG + Intergenic
1087562043 11:99802767-99802789 TCTCTTTTGTGAAGAGATCCCGG - Intronic
1088065044 11:105707145-105707167 TTTCTATTGTCATCAAAGCCAGG - Intronic
1088482037 11:110303497-110303519 TTGCTAGTTTGAATAAAACCTGG + Intergenic
1088526650 11:110763066-110763088 TTCTTATTGTGATCAAAACCTGG - Intergenic
1088987919 11:114926392-114926414 TTTCTGTTCTGCAGAAAAACTGG - Intergenic
1090608299 11:128447879-128447901 TTTCAATAGTGAAGAATATCAGG + Intergenic
1090967579 11:131612433-131612455 TTTTTATTGTGAAGAATATTTGG + Intronic
1091642540 12:2248401-2248423 TTTCCATTGTGAAGGAACCGAGG + Intronic
1092573703 12:9755131-9755153 TTTCTACTGTGAAGAGGAGCTGG - Exonic
1092826729 12:12407275-12407297 TTTACATTTGGAAGAAAACCTGG + Intronic
1092955924 12:13549762-13549784 TTTCCACGGTGAAGAAAACTTGG - Exonic
1092969887 12:13683461-13683483 TTTTTATGGTGAAGAAAATAAGG - Intronic
1096267702 12:50137060-50137082 TATCTTTGATGAAGAAAACCAGG - Intronic
1096579307 12:52574208-52574230 TTTCTTTTGGGAAGAAACCTGGG - Intergenic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1097687348 12:62703448-62703470 TTTCTAATGAGAAGAAAACAAGG - Intronic
1097799622 12:63899353-63899375 TTCCTATTATGTAGCAAACCTGG - Intronic
1098254267 12:68600458-68600480 TTTATTATGTGAAGAAAACATGG - Intergenic
1099537952 12:83868228-83868250 TTTTTATTCTGATTAAAACCTGG + Intergenic
1099566286 12:84251685-84251707 TTTAAAATGTTAAGAAAACCTGG + Intergenic
1099695135 12:86009845-86009867 TTTATAATGGAAAGAAAACCAGG - Intronic
1099863346 12:88246814-88246836 TTTTTTTTTTAAAGAAAACCTGG - Intergenic
1099868590 12:88317375-88317397 TATCTAATGTTAAGAAAACTTGG + Intergenic
1100796601 12:98188482-98188504 TATCTATAGTGAAGAAAAATTGG - Intergenic
1102126439 12:110485487-110485509 TTTCTATTTTCAAGAAAAGATGG - Intronic
1102701245 12:114841336-114841358 CTGCCATTGTGAAGAAAAACTGG - Intergenic
1102890234 12:116552970-116552992 TTTCTATATTTAAGAAACCCAGG + Intergenic
1106416039 13:29546711-29546733 TTTTTTTTGTGAAAAAAACTTGG + Intronic
1108238645 13:48437164-48437186 TTAGTCTTGTGAAGGAAACCAGG - Intronic
1109206062 13:59484045-59484067 TTTCAATTGTGAGTAAAATCAGG + Intergenic
1109822757 13:67680176-67680198 ATTCTATTGTGAGGAACTCCTGG + Intergenic
1109856993 13:68143744-68143766 TTTCTCTTGAGCAGATAACCAGG - Intergenic
1111552048 13:89826117-89826139 CCTCTATTGTGAAGAAATCTTGG - Intergenic
1113134785 13:107077465-107077487 TTTTTATTGTGAAGAAGATTTGG + Intergenic
1113257389 13:108521979-108522001 ATTCTATTGAGAAGAAAGACTGG - Intergenic
1115060092 14:29177106-29177128 TTTCTCTTGTGAGAAAAACCTGG + Intergenic
1115563402 14:34603103-34603125 TTTCTATTTTGAAGTAAAGATGG - Intronic
1115826934 14:37289134-37289156 TTTTTATTGTGAGGAATCCCTGG + Intronic
1116540344 14:46094444-46094466 TTTCTATTGTTAACAATATCAGG - Intergenic
1117281667 14:54247536-54247558 TTTCTGTTGTGAAATAAACTTGG - Intergenic
1119288588 14:73476219-73476241 TTTCTGTTGTGAAGAAACTTGGG + Intergenic
1119373998 14:74173966-74173988 TGTCTTTAGTGAAGAAACCCAGG + Intronic
1119920157 14:78439216-78439238 TTTGTATCTTGAAAAAAACCAGG + Intronic
1120291105 14:82571929-82571951 TTTCTGTGGATAAGAAAACCTGG + Intergenic
1120474559 14:84970615-84970637 TTTTTAATGTGCAGAACACCAGG - Intergenic
1121006105 14:90491653-90491675 TTGCCATGGTGATGAAAACCTGG + Intergenic
1123791602 15:23726669-23726691 TTTCTCAGGTGAAGAAAAACTGG - Intergenic
1124396813 15:29309465-29309487 TTTCTATAGAGAAGAAAGCCAGG - Intronic
1125408668 15:39381953-39381975 TTTCTATTGTGAATAGTGCCAGG - Intergenic
1125824115 15:42661017-42661039 ATTCTAATGTGATGTAAACCAGG - Intronic
1126252240 15:46581855-46581877 TTTCTATTTTGAGGAAGACTAGG + Intergenic
1127534129 15:59874227-59874249 TTTCTGTGGACAAGAAAACCGGG + Intergenic
1127749030 15:62014335-62014357 TTTGTAATAGGAAGAAAACCAGG + Intronic
1129791841 15:78346285-78346307 TCTCTATTGGGAAGAAATGCAGG - Intronic
1129881923 15:79012522-79012544 GTCCTCCTGTGAAGAAAACCAGG + Exonic
1131157875 15:90085881-90085903 TTTCTATTGTCAAGGACTCCAGG + Intronic
1137898063 16:52235540-52235562 TTGCAATTTTGGAGAAAACCTGG - Intergenic
1138314036 16:56052986-56053008 TTGCTATTCTGAACAAAATCAGG + Intergenic
1139184387 16:64788408-64788430 TTTCTATTGTGTATATACCCAGG + Intergenic
1139270559 16:65678772-65678794 AATTTATTGAGAAGAAAACCAGG - Intergenic
1140413884 16:74759560-74759582 TTTCTCTTGTTTAGAAAACAAGG - Intronic
1140982921 16:80127851-80127873 TTTTTTTTTTTAAGAAAACCAGG + Intergenic
1141961756 16:87413609-87413631 TTTCTATTGTGAAGAAAACCCGG + Intronic
1144245857 17:13363775-13363797 TATCTATTGTCATGAAATCCAGG + Intergenic
1144633835 17:16891102-16891124 TGTCTATTGTGAAGAAGATCAGG - Intergenic
1146960745 17:36974780-36974802 TTTCTTTTGTGAATCAAACAGGG + Intronic
1148317577 17:46716990-46717012 TTATAATTGTGAAAAAAACCTGG - Intronic
1148893490 17:50825225-50825247 TTTCTCTTGTGTAGACACCCAGG + Intergenic
1150658681 17:67057128-67057150 TTTTTCTTGTGAAGAACATCAGG + Intergenic
1151929625 17:77223960-77223982 TTTTTATTGTAAAGTAAACACGG - Intergenic
1153731031 18:8011993-8012015 TTTTTGTAGAGAAGAAAACCAGG + Intronic
1155399783 18:25425352-25425374 TTTGTTTTGTGAGGAAATCCGGG - Intergenic
1156377221 18:36525470-36525492 TTTCCATGGTGCAGAAATCCAGG - Intronic
1157999549 18:52600263-52600285 TTGGAATTGTGAGGAAAACCTGG - Intronic
1158479673 18:57810472-57810494 TTTCTACAGTCAAGAAAAGCAGG - Intergenic
1158573878 18:58619790-58619812 TTTCTCTTGGGAAGATAACTTGG - Intronic
1160539965 18:79615442-79615464 TTGAAATTGAGAAGAAAACCTGG - Intergenic
1160617056 18:80138270-80138292 TCACTGTTGTGAATAAAACCCGG - Exonic
1161192323 19:2965109-2965131 TTTCTTTTGAGAGGAAAGCCAGG + Intergenic
1165224989 19:34348476-34348498 TTTTTATTGTAAAGACAACTGGG + Intronic
1168228576 19:55014336-55014358 TTTCTAATGTGAAGGGAAGCGGG + Exonic
925684342 2:6456461-6456483 TTTCTTTTGAGCACAAAACCGGG - Intergenic
925690686 2:6520066-6520088 TTTATATTGTTAAGAACTCCCGG - Intergenic
925862845 2:8197133-8197155 TTTCTATTAGGAAGAAAACTGGG + Intergenic
927530265 2:23791281-23791303 TTTCTTTTGTGTAGATAACTAGG + Intronic
929500875 2:42490598-42490620 TTTCTGTTGTAAAGAAAAGTTGG - Intronic
930793165 2:55356444-55356466 TTTCTTTTGTTAAAAAAACTAGG - Intronic
930931700 2:56892368-56892390 TATCTTTTGTGAAAAAAAGCCGG - Intergenic
934978004 2:98819180-98819202 ATTTTATAGTGAAGAAAGCCTGG + Intronic
935391047 2:102553042-102553064 CTTCTAATGAGAAGAAAACAAGG - Intergenic
937902658 2:127033661-127033683 TTTATATTCTGCAGAAAGCCTGG + Intergenic
939491258 2:142879729-142879751 TCTATATTGAGATGAAAACCTGG - Intronic
939768318 2:146282042-146282064 TTTCTAGGTTGAAGAAAACATGG + Intergenic
942299192 2:174546066-174546088 TTTCTGTTGTGAAGAAGGCAAGG - Intergenic
943105019 2:183534367-183534389 TTTCTATTGTATAGATAACCAGG + Intergenic
943168083 2:184357984-184358006 TTTCTATTTTGAAAAAAATCAGG + Intergenic
943603474 2:189949255-189949277 TTTTTATTGAGAAAAAAAGCCGG + Intronic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
945197879 2:207254237-207254259 TTTCGACACTGAAGAAAACCTGG + Intergenic
945416469 2:209578945-209578967 TTTCTCTTGTAAGGAAAACATGG + Intronic
945692021 2:213048031-213048053 TATCTATTATGAAGAAAATTAGG + Intronic
946031373 2:216707796-216707818 CCTCTATTTTGCAGAAAACCAGG - Intergenic
948605120 2:239130098-239130120 CTTCCATTGAGAAGCAAACCAGG + Intronic
1171036760 20:21718702-21718724 TTTCTTTTGAAAAGAAACCCAGG - Intergenic
1172836315 20:37875444-37875466 TTTCCCCTGTGAAGAAACCCTGG - Intergenic
1173038615 20:39437319-39437341 ATTCTATTGAGAGGAAAACAAGG - Intergenic
1174724739 20:52849811-52849833 TTTTTATTGAGAAGAAAAATGGG - Intergenic
1176700476 21:10042886-10042908 TTTCTAATTTGCAGAAAACAAGG - Intergenic
1177412145 21:20743222-20743244 TTTCTCTTGTGTAGAAAAATTGG - Intergenic
1177719824 21:24891659-24891681 TTTCAACTGTCAAGAAAATCTGG + Intergenic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
1178171495 21:30045643-30045665 ATTCTAATTTGAAGATAACCAGG + Intergenic
1179880311 21:44290860-44290882 TCCCTATTGGGAAGAAAACCCGG - Intronic
1184869666 22:47227680-47227702 TTTGAATTTTGAAGAAAATCTGG + Intergenic
949275745 3:2278241-2278263 TTTGTACTGTGAAGAAAATGAGG - Intronic
951430652 3:22603127-22603149 TTTCTCCTGTGCAGACAACCTGG + Intergenic
951790814 3:26482117-26482139 TTTTTATTGTAATGAAAAACTGG - Intergenic
952047121 3:29336016-29336038 TTTCCTTTGTTAAGAAAAACCGG - Intronic
952998004 3:38904056-38904078 TCTCCCTTGTGGAGAAAACCTGG - Exonic
954109605 3:48426708-48426730 TTTTTAGTGTGCAGAAAACAGGG + Intronic
955691362 3:61593435-61593457 TTTTAACTGTGAGGAAAACCTGG - Intronic
956311568 3:67886590-67886612 TTCCTAATGTGACCAAAACCTGG + Intergenic
957030662 3:75236628-75236650 TTTAAAATGTGAAAAAAACCAGG + Intergenic
957932018 3:86892414-86892436 CTTCATTTGTGAAGAAAACATGG + Intergenic
959266371 3:104145438-104145460 TTTATATTTTGAAGAAAATGTGG + Intergenic
959395069 3:105826932-105826954 CTTGCATTTTGAAGAAAACCAGG - Intronic
960230325 3:115218776-115218798 TTTCTTTTGTGAAGAAAACAAGG + Intergenic
960389218 3:117056267-117056289 TTTCTCTGTGGAAGAAAACCTGG - Intronic
960515769 3:118600747-118600769 TGTCTATTGGGAAGAAGACTGGG - Intergenic
961709475 3:128816550-128816572 TTACTTTTGTGAAGAATATCTGG + Intergenic
961849833 3:129805091-129805113 TTAATATGGTGAAGGAAACCTGG - Intronic
961850331 3:129810822-129810844 ATTCTATGGAGCAGAAAACCTGG + Intronic
963235900 3:142955561-142955583 TTTCTATTCTGAAGAAACAAGGG + Intronic
963273921 3:143312029-143312051 TTTTTATGGAGAACAAAACCTGG + Intronic
963354873 3:144198465-144198487 TGTCTAGTTTGAAGAAAAGCAGG - Intergenic
963558295 3:146825324-146825346 TTTGTTTAGTCAAGAAAACCTGG - Intergenic
964008061 3:151854822-151854844 TTTGATTTGTGATGAAAACCTGG - Intergenic
964291015 3:155180078-155180100 GTTCTATTGTGCAGAAACCAAGG + Intronic
966157326 3:176930910-176930932 TTTCTAGTGTTAAGTAAAACTGG + Intergenic
966625969 3:182017429-182017451 TTTCTATTCTGAAAGAAGCCAGG - Intergenic
968770663 4:2504042-2504064 TTTCTTTTTTGAAGAAGACAGGG - Intronic
970627104 4:17898543-17898565 TCTCTTTTGTGTAGAAAAGCAGG - Intronic
971138170 4:23892995-23893017 TTTCTATTGTTGAGAAAAAATGG - Intronic
973639867 4:52892129-52892151 TTTCTATTGGGAAGCAGAACTGG - Intronic
974694465 4:65347535-65347557 TTTCCATTGTGGGGAAAATCTGG + Intronic
974986483 4:69033744-69033766 TTTCTTTTTTGAAAAAAAACTGG + Intronic
976749492 4:88439718-88439740 GTTGTATTGTGACCAAAACCTGG - Intronic
976779551 4:88743720-88743742 TTTATATTATGAAGACAACTTGG - Intronic
978150119 4:105424684-105424706 TGTGTATTGAGCAGAAAACCAGG - Intronic
980298609 4:130957772-130957794 TTACTAGTGTGGGGAAAACCCGG - Intergenic
980372888 4:131901643-131901665 TTTCTAATTTGCAGAAAACAAGG - Intergenic
980482013 4:133399333-133399355 TCTCCAATGGGAAGAAAACCTGG - Intergenic
980976202 4:139612842-139612864 ATTTTATTGTTAAGGAAACCGGG + Intergenic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
982262049 4:153502876-153502898 CTTCTATTATGAAGATAACTAGG + Intronic
982908046 4:161102367-161102389 TTTCCACTGTGAAGACTACCAGG + Intergenic
984658241 4:182343448-182343470 TTTCCAATGTAAAGAAAACATGG + Intronic
986093223 5:4531701-4531723 TTTCTATTGTGAAGCTAAATTGG + Intergenic
987539348 5:19234251-19234273 TTTCAATTGTCACCAAAACCTGG - Intergenic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
990977619 5:61573242-61573264 TTCCTATAGGGAAAAAAACCTGG - Intergenic
992834760 5:80629270-80629292 TTACCATTGTGAAGAAAAAAGGG - Intronic
994132367 5:96245214-96245236 TTTCTTTGCTGAAGAAAAACTGG + Intergenic
994132881 5:96250638-96250660 TTGCTATTGTGAATAAAAGCAGG + Intergenic
994525597 5:100901699-100901721 TTGCTATTCTGTAGAAAACCAGG - Intronic
995463210 5:112423981-112424003 TATCTATTGTCAAGAAATTCAGG - Intergenic
996048807 5:118909048-118909070 TTTCTCTTGTGAAGGGAACTCGG - Intronic
996283565 5:121762180-121762202 TTTCTAATGTAATGAAAATCTGG - Intergenic
996614070 5:125418902-125418924 TTTCTATTAAGAAGAAAATTGGG + Intergenic
996974968 5:129421142-129421164 TTTCTTTAGTGAAGAAAACCTGG - Intergenic
997061621 5:130511652-130511674 TTTTTGTTTTGAATAAAACCCGG + Intergenic
997215220 5:132104333-132104355 TTTCCTGTGTGCAGAAAACCAGG + Intergenic
997418131 5:133744915-133744937 TTTCTATGGTGATGCAGACCAGG - Intergenic
1000069700 5:157728479-157728501 GTTATACTGTGAAGAAAACTTGG - Intergenic
1000553907 5:162700299-162700321 TTTCTATTTTGGAGAAAGCATGG + Intergenic
1000734218 5:164879042-164879064 TTTCTATGGGGCAGAAATCCAGG - Intergenic
1000770265 5:165344198-165344220 GTTCTGTGATGAAGAAAACCAGG - Intergenic
1000983208 5:167839215-167839237 TTTCTATTCTCATGAAAAGCAGG - Intronic
1004465233 6:15879034-15879056 AGTCTATTGGGAAGAAAAACAGG - Intergenic
1005174052 6:23024041-23024063 TTTCTATTATGAAATTAACCAGG + Intergenic
1007067360 6:39005018-39005040 TTTCTCTTGTGTAGATAACTAGG + Intronic
1008364930 6:50667009-50667031 TTTCTGTTGTGAAGTCACCCAGG - Intergenic
1009356176 6:62748884-62748906 TTTCTTGTGTGAAGAAAATATGG + Intergenic
1009897198 6:69766825-69766847 TTTCTTGTGTGAAGAAATCTAGG + Intronic
1010874488 6:81085323-81085345 TTTCTAATGCGAAGATAGCCTGG + Intergenic
1010945226 6:81966196-81966218 TTTCTATTCTGATGAAGACTAGG + Intergenic
1011928900 6:92684871-92684893 TTGCTGTTATGAAGAAATCCAGG - Intergenic
1012110759 6:95229282-95229304 TTTAAATTGTAAAGGAAACCTGG + Intergenic
1012163034 6:95911718-95911740 TTTCTTTTGAGAAAAAAACCTGG - Intergenic
1012466848 6:99524868-99524890 TTCCTATATTGAAGAAAAACTGG - Intergenic
1012618838 6:101314206-101314228 TTTTTATTGTAAAGAAGACTTGG - Intergenic
1012696821 6:102394514-102394536 TTTCTTTTGGGTAGATAACCAGG - Intergenic
1013987697 6:116215587-116215609 GTTATATTTTGAATAAAACCAGG + Intronic
1014744790 6:125188037-125188059 TTTCTATTGAGAAGAGGTCCTGG + Intronic
1015469906 6:133592596-133592618 TTTATATTGTGTTGAAAACAGGG - Intergenic
1017517664 6:155171826-155171848 TTACTGTTGTTAAGAAAACTGGG + Intronic
1018882492 6:167898738-167898760 TTTCTTTTGTGAAAAAAACATGG + Intronic
1021112114 7:16707490-16707512 TTTCTTTTCTGAAGACAAACAGG - Intergenic
1024462906 7:49678570-49678592 GTTCTATTGTGTAAAATACCTGG - Intergenic
1024710181 7:52006591-52006613 TTTTCATTCTGAAGAAAACGTGG + Intergenic
1026558724 7:71430150-71430172 TTTTTTTTGTCAAGAAATCCTGG - Intronic
1027542037 7:79478778-79478800 TTTCTATTGTGAAAGAGAGCAGG - Intergenic
1027856458 7:83518095-83518117 TTTCTTTCATGAAGAAAAGCAGG - Intronic
1028323559 7:89493554-89493576 TTTCTATGCTGAAGAAAATCAGG - Intergenic
1030726600 7:112933654-112933676 TTTCTGTTGCAAAGAAAAGCAGG - Intronic
1030878364 7:114844328-114844350 GTTCTTATGTGAAGAAAACAGGG + Intergenic
1030992594 7:116318100-116318122 TTACTCTTGTGAGGAAAGCCAGG - Intronic
1031016822 7:116584605-116584627 TATCTATAATCAAGAAAACCAGG - Intergenic
1031214438 7:118871665-118871687 TTTATTTTGTGATGAAAAACTGG + Intergenic
1032141806 7:129338042-129338064 TTTTTGTTGTAAAGAAAAACTGG - Intronic
1032330956 7:130978895-130978917 TTTCTTTTTTCAAGACAACCAGG - Intergenic
1032938495 7:136761640-136761662 TTTCAATTGTGAAGACAAGCTGG + Intergenic
1032970363 7:137155944-137155966 TTTCATTTGAGAAGAAAAGCAGG + Intergenic
1033109024 7:138558662-138558684 TGTATATTATAAAGAAAACCTGG - Intronic
1034953222 7:155315501-155315523 TATCTAGTATGGAGAAAACCTGG - Intergenic
1035263980 7:157679534-157679556 GTTCTATTTTGAGGAAAAACAGG + Intronic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1037222816 8:16545675-16545697 TTTTTATTGTGATAAAAAACAGG - Intronic
1037661521 8:20931522-20931544 TTTACATTATTAAGAAAACCCGG + Intergenic
1042414454 8:68503033-68503055 TTTTTGTTGTTCAGAAAACCTGG - Intronic
1044533131 8:93330537-93330559 TTACTAGTGTGAAAAAAGCCTGG + Intergenic
1046327587 8:112670330-112670352 TTTCCATAGTGGAGCAAACCAGG - Intronic
1047173380 8:122516622-122516644 TTTTTATTGAAAAGAAAACAGGG - Intergenic
1047243803 8:123120366-123120388 TTTTTATTTAGAAGAAAATCTGG + Intronic
1047899049 8:129399676-129399698 TTTCTATTTTGCAGCAAACTTGG - Intergenic
1048117673 8:131543784-131543806 CTTCTGTGATGAAGAAAACCTGG - Intergenic
1049728757 8:144164728-144164750 TTTTTTTTCTGATGAAAACCTGG - Intronic
1050770486 9:9192476-9192498 TTTCTGTTGGGATTAAAACCAGG - Intronic
1051398255 9:16650511-16650533 TTTCTACTGTGAAAACAGCCAGG - Intronic
1052160495 9:25252408-25252430 TTTGCATTGTGATGAAACCCTGG - Intergenic
1052208950 9:25878352-25878374 TTTCTATTTTAAAGAAAAATAGG - Intergenic
1053637676 9:40029692-40029714 TTTCTAATTTGCAGAAAACAAGG - Intergenic
1053768405 9:41435529-41435551 TTTCTAATTTGCAGAAAACAAGG + Intergenic
1054318468 9:63626286-63626308 TTTCTAATTTGCAGAAAACAAGG - Intergenic
1054547074 9:66347027-66347049 TTTCTAATTTGCAGAAAACAAGG + Intergenic
1055556070 9:77475330-77475352 TTGCTATGGTTAAGAAAACATGG + Intronic
1057224684 9:93285931-93285953 TTTCTGTTGAGAAGACCACCCGG - Intronic
1058341241 9:103899687-103899709 TTTTTTTTGTGAAGAAAAAGTGG - Intergenic
1060027814 9:120187708-120187730 TTTCTTTTCTCAAGAAACCCCGG - Intergenic
1060486145 9:124047874-124047896 ATTCTAGAATGAAGAAAACCTGG - Intergenic
1061629368 9:131862274-131862296 TTTCTAGCATGAAGAAAACAGGG + Intronic
1062608736 9:137362408-137362430 TTTCTATTGAGATGAACACATGG - Intronic
1202785487 9_KI270719v1_random:12954-12976 TTTCTAATTTGCAGAAAACAAGG - Intergenic
1186269148 X:7866274-7866296 GGTCAGTTGTGAAGAAAACCTGG + Intergenic
1186713206 X:12222400-12222422 ATGCTAGTGGGAAGAAAACCAGG + Intronic
1187620819 X:21052209-21052231 TCTCTAGTGTGAAAAAAACAAGG + Intergenic
1187853243 X:23611743-23611765 ATTCTCTTGGGAAGAAAAACGGG - Intergenic
1188144234 X:26589614-26589636 TTTCTTTTGTGAAAAAGACAGGG - Intergenic
1188316795 X:28684563-28684585 TTTCTATTCAGAAAAAAACAAGG + Intronic
1188638237 X:32463134-32463156 TTTATGTTCTGAAGAAAACATGG + Intronic
1191048480 X:56165126-56165148 TTGCTATTGTGAATAAAATGTGG - Intergenic
1191593530 X:62916183-62916205 TTTCTATTATGAGGGAAGCCTGG - Intergenic
1193275715 X:79585234-79585256 ATTCCATTTTGAATAAAACCAGG - Intergenic
1194399514 X:93426015-93426037 TTTCTCTTGTAAAGCAAAACTGG + Intergenic
1194711756 X:97244388-97244410 TTACTATTGTGACCTAAACCTGG + Intronic
1194850969 X:98868570-98868592 GTATTATTGGGAAGAAAACCAGG + Intergenic
1195446378 X:104957278-104957300 TTTGCATTCTGAAGAACACCTGG - Intronic
1198170213 X:134097889-134097911 TTGCTATTGTGAATAATGCCAGG - Intergenic
1199184237 X:144896422-144896444 TTTCTATGGTATAGAAAAACTGG + Intergenic
1200823714 Y:7617231-7617253 TTTTTTTTGTAGAGAAAACCTGG + Intergenic
1202191124 Y:22246770-22246792 TTTTTTTTTTTAAGAAAACCTGG + Intergenic
1202236342 Y:22713857-22713879 TTTTTTTTGTAGAGAAAACCTGG - Intergenic
1202306823 Y:23482311-23482333 TTTTTTTTGTAGAGAAAACCTGG + Intergenic
1202563984 Y:26188275-26188297 TTTTTTTTGTAGAGAAAACCTGG - Intergenic