ID: 1141962458

View in Genome Browser
Species Human (GRCh38)
Location 16:87418410-87418432
Sequence CAGTGCACACGCACCCCCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 72}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141962458_1141962462 14 Left 1141962458 16:87418410-87418432 CCTATGGGGGTGCGTGTGCACTG 0: 1
1: 0
2: 0
3: 12
4: 72
Right 1141962462 16:87418447-87418469 ACCTCACTGTCAGCAAAGATGGG 0: 1
1: 0
2: 0
3: 12
4: 134
1141962458_1141962461 13 Left 1141962458 16:87418410-87418432 CCTATGGGGGTGCGTGTGCACTG 0: 1
1: 0
2: 0
3: 12
4: 72
Right 1141962461 16:87418446-87418468 CACCTCACTGTCAGCAAAGATGG 0: 1
1: 0
2: 1
3: 20
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141962458 Original CRISPR CAGTGCACACGCACCCCCAT AGG (reversed) Intronic