ID: 1141962950

View in Genome Browser
Species Human (GRCh38)
Location 16:87421521-87421543
Sequence CTTGCAGCCCAGCCTGATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 224}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141962950_1141962954 13 Left 1141962950 16:87421521-87421543 CCAGGATCAGGCTGGGCTGCAAG 0: 1
1: 0
2: 0
3: 18
4: 224
Right 1141962954 16:87421557-87421579 GCCCCCACAAGCCCAGCACCAGG 0: 1
1: 0
2: 1
3: 32
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141962950 Original CRISPR CTTGCAGCCCAGCCTGATCC TGG (reversed) Intronic
900410630 1:2510965-2510987 CCTGCAGCCCAGCCCAGTCCCGG - Intronic
901408937 1:9069455-9069477 CTGGCAGCCAAGCCTGCTCTTGG + Intronic
901642452 1:10699497-10699519 CTGGCAGCCCTGGCAGATCCAGG + Intronic
901977747 1:13008859-13008881 ATTGGAGCCCTGCCTGAGCCTGG - Intronic
902004338 1:13220076-13220098 ATTGGAGCCCTGCCTGAGCCTGG + Intergenic
902023558 1:13365814-13365836 ATTGGAGCCCTGCCTGAGCCTGG + Intergenic
902669888 1:17965881-17965903 CTTCAGGCACAGCCTGATCCAGG - Intergenic
903442871 1:23401577-23401599 CCTGCCCCCAAGCCTGATCCTGG + Intronic
904742044 1:32685261-32685283 AATGCATCCCAGCCTGATTCTGG - Exonic
905480940 1:38261562-38261584 CCTGCAGCCCTGTCTGCTCCTGG - Intergenic
905806014 1:40878040-40878062 CTTCCAGCCCAGCAAGAGCCAGG - Intergenic
905850190 1:41268311-41268333 CTTGCAGGCCAGCCTTTCCCTGG - Intergenic
907773724 1:57491826-57491848 TTTGCAGCCCAGTTTGATCGAGG + Intronic
914690525 1:150022011-150022033 CCTGCTTCCCAGCCTGAGCCTGG + Intergenic
914923109 1:151860720-151860742 CCTGCACCCCACCCTCATCCCGG - Intergenic
916057051 1:161074931-161074953 CCTGCTGCCCAGCCTGACCTGGG + Intronic
916808449 1:168283131-168283153 CGTGTTGCCCAGACTGATCCCGG - Intronic
917256001 1:173116854-173116876 CTAGCAGCCCAACCTGACCATGG + Intergenic
917468027 1:175300303-175300325 CTTGTTGCCCAGGCTGATCTAGG - Intergenic
919947238 1:202328539-202328561 CTGGCAGCCCAGTGTGGTCCAGG + Intergenic
920035942 1:203065448-203065470 CTAGCAGCCCAGGCACATCCCGG - Intronic
920198407 1:204244621-204244643 CTTGCAGTGAAGCCTGTTCCTGG - Intronic
922801894 1:228368263-228368285 CTTTAAGCCCAGCCTCCTCCTGG - Intronic
924594575 1:245434382-245434404 CTTGCAGCCCAGCTGGACCCTGG - Intronic
1064092312 10:12395533-12395555 CCTGAATTCCAGCCTGATCCTGG - Intronic
1065390463 10:25176293-25176315 GTTGCAGCCTAACCTGGTCCCGG + Exonic
1065898958 10:30188102-30188124 CCAGCAGCCCAGCCTCCTCCTGG + Intergenic
1067146988 10:43701266-43701288 CCTGCATCCCTGCCTGCTCCAGG - Intergenic
1070607675 10:77910530-77910552 CTTCCCACCCAGCCTGCTCCTGG + Intronic
1070749726 10:78956811-78956833 CTTCCAGCCCTGCCTTAGCCAGG - Intergenic
1070796506 10:79220018-79220040 CTTATGGCCCAGCCTGCTCCTGG - Intronic
1071875382 10:89837967-89837989 CTTGCAGCCCAACCAGGTCTCGG - Intergenic
1072281643 10:93871006-93871028 GCTGCACCCCAGCCTGAGCCTGG + Intergenic
1072816048 10:98510419-98510441 GTTGCAGCCCATGCAGATCCTGG - Intronic
1073036107 10:100565181-100565203 CGTCCAGCCCAGCCTCACCCTGG - Intergenic
1075743842 10:124712740-124712762 CTGGCACCCCAACCTGATCATGG + Intronic
1075872703 10:125782308-125782330 CTTGCAGTTCAGCCTGAGCCTGG - Intergenic
1077024253 11:432272-432294 CCCCCAGCCCAGCCTCATCCTGG - Intronic
1077174330 11:1181746-1181768 CTGGCAGCCCAGGCTGGCCCCGG + Intronic
1077278895 11:1733085-1733107 CTTCCAGCCCAGGCTTGTCCAGG + Exonic
1077504418 11:2923529-2923551 TTTGCAGCCCGGCCACATCCGGG - Intronic
1078895329 11:15592309-15592331 CCTGCAGCCCAGCCAGATAAAGG + Intergenic
1084033505 11:66494355-66494377 GTTCCAGCCCTTCCTGATCCAGG - Intronic
1084451987 11:69244489-69244511 CAGGCAGCCCGGCCTGATACAGG - Intergenic
1084524419 11:69686842-69686864 CTTGGAGCCCTGCCTGTTCTGGG + Intergenic
1084666792 11:70580713-70580735 CTGGCTGCCCAGCCAGAGCCAGG + Intronic
1095719022 12:45380313-45380335 CATGCAGCCAAGTCTGATCCAGG - Intronic
1100748189 12:97668295-97668317 CTTGGAGCCCAGACTGCTTCTGG + Intergenic
1102913800 12:116738021-116738043 CCCGCAGCCCAGTCTGCTCCCGG + Exonic
1104329756 12:127833748-127833770 CTCCCAGCCCAGCCTGAGGCAGG + Intergenic
1104539786 12:129653193-129653215 CATGCAGCCCCTCCTCATCCTGG - Intronic
1105279422 13:18954537-18954559 CTTCCAGCCCAGCCCCACCCAGG + Intergenic
1110322484 13:74175786-74175808 CTTGTGGCTCAGCCTGAGCCAGG + Intergenic
1111932051 13:94522725-94522747 TTTGCAGCTCACCATGATCCTGG + Intergenic
1114035898 14:18626929-18626951 CGCGCAGCGCAGCCTGAGCCGGG + Intergenic
1114458721 14:22873404-22873426 CTTGCTGCCCAGGATGAGCCAGG - Exonic
1117197477 14:53354682-53354704 CTGGGAGCCTAGCCTCATCCTGG + Intergenic
1117307607 14:54491781-54491803 TTTGCAGCCCAGCCTGCTCAAGG - Intergenic
1119347233 14:73936025-73936047 CCTCCAGCCCAGCCTGCTTCAGG + Exonic
1119682688 14:76604749-76604771 CTGGCAGCCCAGTCTGACTCTGG + Intergenic
1121013418 14:90534753-90534775 CCTGCAGCACAGCCGGCTCCAGG - Exonic
1121998815 14:98628991-98629013 CTTGCACTTCAGCCTCATCCTGG + Intergenic
1122127242 14:99586036-99586058 CCTCCAGCCCTGCCTGATTCTGG - Intronic
1122842600 14:104473674-104473696 CTTGAAGCCCAGCCTGAAGGTGG + Intergenic
1124639449 15:31387749-31387771 CCTGCAGGCCTGCCTGAACCTGG - Intronic
1125884030 15:43215061-43215083 CATGCAGCCCAGGCTGGCCCAGG + Intronic
1126407482 15:48336048-48336070 TTTGCAGCCAAGCCTGACCGTGG - Exonic
1126414812 15:48406495-48406517 CTTGCCACCCCGCCTGATCATGG + Intergenic
1128468207 15:67930222-67930244 TGTCCAGCCCAGCCTGGTCCAGG - Intergenic
1129153334 15:73702779-73702801 CTCGAAGCCCAGCATGACCCTGG + Exonic
1129153646 15:73704183-73704205 CTCGAAGCCCAGCATGACCCTGG + Exonic
1129157650 15:73728769-73728791 CTTGTAGGCCAGCCTTCTCCTGG + Intergenic
1129360431 15:75020804-75020826 CTTACAGGCCATCCTGAGCCAGG + Exonic
1135666176 16:24337388-24337410 CGTGGGCCCCAGCCTGATCCTGG - Intronic
1137448597 16:48549677-48549699 CTTGCATACCAGCCTGGTGCAGG + Intronic
1137947034 16:52743427-52743449 CTTGCAACACAGCTTGACCCAGG + Intergenic
1140137227 16:72217800-72217822 CTTGTTGCCCAGGCTGATCTTGG - Intergenic
1141148232 16:81546961-81546983 TTTGCAGCCCAGCACCATCCAGG - Intronic
1141962950 16:87421521-87421543 CTTGCAGCCCAGCCTGATCCTGG - Intronic
1142003612 16:87678720-87678742 ATTGGGGCCCAGCCTGATCCAGG - Intronic
1142108377 16:88318325-88318347 CCTCCAGCCCAGCCTCCTCCTGG + Intergenic
1142262687 16:89050241-89050263 ATTCCAGCCCTGCCTGACCCAGG - Intergenic
1142966740 17:3586349-3586371 CCTGCCGCCCTGCCTGACCCAGG - Intronic
1143012929 17:3876187-3876209 CTTGAACCCCAGCCTGGCCCAGG + Intronic
1143383131 17:6508696-6508718 CCTGCAGCGCAGCCTGAGCCAGG + Intronic
1143670529 17:8393026-8393048 CCTGCTGCCCAGCCTGCCCCGGG - Exonic
1144028137 17:11296615-11296637 ATTTCAGCCCAGGCTGCTCCTGG - Intronic
1144942440 17:18951074-18951096 TTTGCAGGCCAGCGTGTTCCTGG + Intronic
1145013782 17:19384181-19384203 CATGGAGCCCAGCCAGGTCCAGG + Exonic
1147630118 17:41924811-41924833 CATGCAGCCCAACCAGGTCCAGG + Intronic
1147689998 17:42309154-42309176 CCTGCCTCCCATCCTGATCCTGG + Intronic
1147778994 17:42926139-42926161 CTTGTTGCCCAGGCTGATCTTGG + Intergenic
1148065315 17:44864952-44864974 TTTGCAGACCAGCCTGAGCAAGG + Exonic
1150287005 17:63960324-63960346 CTTCCAGCCCAGCCTGGCCATGG + Intronic
1152364678 17:79848755-79848777 CTTGCTTCTCAGCCTGACCCAGG + Intergenic
1152408917 17:80112249-80112271 CCTGCACCCCAGCCTGAAGCTGG + Intergenic
1152783417 17:82236363-82236385 GTTGCTGCCCAGCAGGATCCTGG - Intronic
1155002892 18:21704277-21704299 CTCGGAGCGCAGCCTGAACCCGG - Intronic
1160311277 18:77793139-77793161 CTTGCCCCCCAGCCTGAGACAGG + Intergenic
1160316231 18:77850316-77850338 CCTGCAGCCCAGCCTGGTGTTGG + Intergenic
1160329242 18:77977248-77977270 CTGGGAGCCCTGCCTGGTCCAGG + Intergenic
1161135665 19:2618107-2618129 CTGGGGGCCCAGCCTGATACAGG - Intronic
1161687876 19:5712330-5712352 CTTGGAGACCAGCCTGTGCCCGG - Intronic
1162723111 19:12674129-12674151 TCTGCAGCCCAGCCTGACCCCGG - Intronic
1166293621 19:41878503-41878525 TTTGCACCCCAGCCTCAGCCAGG - Intronic
1167302701 19:48687977-48687999 CTTGCAGCCCAGGCTGAGTGTGG - Intergenic
925075865 2:1014981-1015003 CATGCAGCCCAGCCCCCTCCCGG - Intronic
926371444 2:12182750-12182772 CAGGCTGCCCAGCCTGGTCCAGG + Intergenic
929574090 2:43041454-43041476 CTGGGAGCCCAGTCTGATCATGG - Intergenic
932345777 2:70994500-70994522 CTGGCAGCCCGGCCTGACCGTGG - Intronic
932621239 2:73265846-73265868 CATGCAGCCCACCCTCACCCTGG - Intronic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
935849690 2:107205038-107205060 CCTGCAGCCCAGCCTTGCCCTGG + Intergenic
937320521 2:120958091-120958113 CGTGCAGCCAGGCCTGACCCAGG - Intronic
945877263 2:215291451-215291473 CCAGCAACCCAGCCAGATCCAGG - Intergenic
947710443 2:232310810-232310832 CTTGCTGCCCTCCCTGCTCCTGG - Intronic
947712254 2:232322979-232323001 CTTGCTGCCCTGCTTGCTCCTGG - Intronic
947766495 2:232641241-232641263 CATGTTGCCCAGCCTGGTCCTGG + Intronic
948410416 2:237755436-237755458 CTTGCAGGGCAGCCTCACCCAGG + Intronic
948644472 2:239395227-239395249 CTGGAAGGCCTGCCTGATCCTGG - Intronic
1170634580 20:18093294-18093316 CTTGAAGCACAGCTTGATTCAGG - Intergenic
1171161325 20:22926504-22926526 CTTGCCTCCCACCATGATCCTGG + Intergenic
1171210114 20:23310402-23310424 CTTGCAACCCAGGCTGGTGCAGG - Intergenic
1173897716 20:46563362-46563384 CTTGCGGCCCACCCACATCCCGG + Intronic
1173991210 20:47305039-47305061 CTTGCTGCCCAGGCTGGTCGCGG - Intronic
1174624660 20:51904115-51904137 CTTGCTGCCCCGCTTCATCCAGG - Intergenic
1174890519 20:54387062-54387084 CTTCCAGCACAGGCTGATCCAGG + Intergenic
1175389877 20:58620297-58620319 CTCCCACCCCAGCCTCATCCTGG - Intergenic
1175403062 20:58711452-58711474 CTCGCAGCCCAGCCTGTGTCAGG - Intronic
1175824831 20:61931155-61931177 CTGGCATCCCAGGCTCATCCAGG - Intronic
1176366494 21:6036047-6036069 CTTGCTGTCCAGCCTGCTCGGGG + Intergenic
1176952470 21:15064335-15064357 CCTGCTGTCCAGCCGGATCCTGG - Intronic
1178138213 21:29652253-29652275 CTTGCACCCCAGGCTGTTCCAGG + Intronic
1179100446 21:38351467-38351489 CTTGCTGCCCAGCATGTCCCAGG + Intergenic
1179598857 21:42462060-42462082 CCTGAAACCCAGCCTAATCCAGG - Intergenic
1179757023 21:43502498-43502520 CTTGCTGTCCAGCCTGCTCGGGG - Intergenic
1180127749 21:45803723-45803745 CTTGGAGCCCATACTGCTCCAGG - Intronic
1180709622 22:17830964-17830986 CTTGCTGCCCAGTCCCATCCGGG - Intronic
1182390813 22:29994038-29994060 CTTCCTGCCCAGGCTGATCCAGG + Intronic
1183175673 22:36223208-36223230 CTGGCATCCCAGCCTGCTGCTGG - Intergenic
1184214628 22:43058590-43058612 CTTGCAGCCCAGTGCCATCCCGG - Intronic
949396076 3:3615892-3615914 CCTGAAGCCCAGTCTGTTCCTGG - Intergenic
949875314 3:8622889-8622911 CCTGCATCCCAACATGATCCTGG - Intronic
950185890 3:10945332-10945354 CTTGTAGCCCAGGCTGAGCCAGG + Intergenic
952621757 3:35352703-35352725 ACTGCAGCCCACCCTCATCCTGG - Intergenic
952768571 3:36976741-36976763 ATGGCAGCCCAGGCTGTTCCAGG - Intergenic
952820541 3:37482223-37482245 CCTGCAGCCCAGGCAGATGCTGG + Intronic
954148071 3:48644113-48644135 CTTGGAGCCCAACCTGCACCAGG + Intronic
954330814 3:49889333-49889355 CTTGGAGCACAGCCTGAGACAGG + Intronic
954615023 3:51965055-51965077 CCTGGAGCCCAGCCTGGGCCCGG - Intronic
955015328 3:55064281-55064303 CCTCCCGCCCACCCTGATCCAGG - Intronic
958533781 3:95368460-95368482 CCTGCAAGGCAGCCTGATCCCGG - Intergenic
961035312 3:123637893-123637915 CTGGCAGCCCACCCTGCTCCTGG - Intronic
961325415 3:126106505-126106527 CTTCCAGCCCAGCCTGGTCTGGG + Intronic
961494863 3:127284241-127284263 CATGCAGCCCAGCCTGAGGTGGG - Intergenic
961541072 3:127599659-127599681 CTTTGAGCACAGCTTGATCCAGG + Intronic
961832558 3:129631570-129631592 CTTGCAGCCCAGCCTTGAACTGG - Intergenic
967849030 3:194068695-194068717 CTTGTTGCCCAGGCTGATCTCGG + Intergenic
967913429 3:194560307-194560329 CCTGGAGCCCGGCCTGACCCTGG - Intergenic
968663218 4:1807296-1807318 CTAGCAGCCCACCCTGCTGCTGG + Exonic
968962513 4:3752762-3752784 GTGGCAGCCCTGCCTGAGCCTGG + Intergenic
969385635 4:6845103-6845125 CTTCCAGCCCAGCATGACCATGG + Intronic
973888470 4:55346438-55346460 CCTGCCGCCCGGCCTGCTCCCGG + Exonic
976002103 4:80386240-80386262 CCTGCAGCCCCGCCAGAGCCAGG + Intronic
976483878 4:85577543-85577565 CTTGGAGCCTAGATTGATCCTGG + Intronic
979117871 4:116850346-116850368 CTTGCTGCACAGCCTGGTGCTGG + Intergenic
980106194 4:128590967-128590989 CTCGCAGCCCAGCCTTATGCTGG - Intergenic
981823224 4:148910085-148910107 ATTGCAAACCAGCCTGATTCAGG + Intergenic
985780741 5:1869538-1869560 CTGCCAGCCCAGCCTCCTCCAGG - Intergenic
986307273 5:6525047-6525069 CTTGCAGACAAGGCTGAGCCAGG - Intergenic
986325084 5:6666781-6666803 CTTGCTGCCCAGCCTGGTGGGGG + Intronic
986626700 5:9729323-9729345 CTTGCCCACCAGCCTGACCCAGG - Intergenic
988898291 5:35702146-35702168 CTTCCAGACCAGCAGGATCCTGG + Intronic
990415474 5:55581862-55581884 CATGTTGCCCAGACTGATCCTGG - Intergenic
990994390 5:61716815-61716837 GTCTCAGCACAGCCTGATCCAGG - Intronic
991718304 5:69472613-69472635 TGTGCTGCCCAGCTTGATCCTGG + Intergenic
992087410 5:73290378-73290400 ATCGCAGGCCAGCCTGCTCCTGG - Intergenic
992944209 5:81793893-81793915 CAGGCAGCACAGCCTGACCCAGG - Intergenic
996973992 5:129408561-129408583 CTTGCAGCCCAGACTTTTCTGGG - Intergenic
997471764 5:134121087-134121109 CTTACTGCCCTGCCTGACCCAGG + Intronic
998262942 5:140644999-140645021 CTTGCAGCCCTGACTGCTGCAGG - Exonic
999264115 5:150255426-150255448 TTTTCAGGCCAGCCTCATCCTGG - Intronic
999996134 5:157094238-157094260 TTTGCTGCCCAGGCTGATCTTGG + Intronic
1002159292 5:177305600-177305622 CTTCCAGCCCATCCTGCTCCTGG - Intronic
1002200326 5:177524367-177524389 CTGCCAGCCCAACCTGGTCCTGG + Exonic
1002616152 5:180457749-180457771 CTAGGTGCCCAGCCTGACCCTGG + Intergenic
1006460922 6:34157462-34157484 CCTGCAATCCAGCCTCATCCAGG + Intergenic
1018337829 6:162814549-162814571 CTGGCAGCCCGGCCTGTTTCAGG + Intronic
1019170099 6:170129008-170129030 CTTGCAGCCTCGCCTCCTCCGGG + Intergenic
1019183340 6:170206878-170206900 CATGCAGCCCAACCAGAGCCAGG + Intergenic
1019534875 7:1523659-1523681 CCTGAAGTCCAGCCTGTTCCGGG + Intergenic
1019551608 7:1606062-1606084 CCTGCAGCCCTGCCTCCTCCAGG + Intergenic
1019792584 7:3026544-3026566 CTTGCACTCCAGCCTGACCTGGG - Intronic
1023470496 7:40513014-40513036 AATGGAGCCCAGCATGATCCGGG + Intronic
1023978366 7:45050833-45050855 CTTGCAGCAGAGCCTGAAACTGG + Intronic
1023983093 7:45080903-45080925 CTTGCACTCCAGCCTCACCCGGG + Exonic
1024234533 7:47388002-47388024 GTTGCAGCCCTGCCTCTTCCAGG + Intronic
1024314713 7:48004758-48004780 CTTGCAGCCTAGGCTGAGGCAGG - Intronic
1024551778 7:50568086-50568108 GTTGCAGCCAAGGCTGTTCCTGG + Intergenic
1027359927 7:77397666-77397688 ATTGGAGCCCAGCTAGATCCAGG + Intronic
1028912569 7:96224902-96224924 CTGGGAGAGCAGCCTGATCCTGG - Intronic
1029384466 7:100234408-100234430 CTTGAAGCCCAGCCTGAGAGCGG - Intronic
1029452642 7:100649802-100649824 CTGTCTGCTCAGCCTGATCCGGG + Intronic
1030216489 7:107048322-107048344 CTTGAAGCCCAGGATGATCAGGG + Intronic
1030360365 7:108589206-108589228 CTTGCAGTCCAGGCTGAGGCTGG - Intergenic
1032019427 7:128398813-128398835 CTTTCAGCCCAGCAGGTTCCTGG + Intronic
1032890666 7:136191519-136191541 ATTGCACTCCAGCCTGAGCCTGG + Intergenic
1033794841 7:144835038-144835060 CGAGCAGCCCAGCCTGAACTCGG + Intronic
1034487262 7:151373799-151373821 CGAGCAGCCCATCCTGATGCCGG + Intronic
1035047479 7:155978155-155978177 CTCGCAGGGCAGCCTGCTCCAGG - Intergenic
1036173754 8:6515996-6516018 CCTGCAGACCAGGCTGTTCCAGG - Intronic
1036706324 8:11049591-11049613 CTCGCTGCCAAGCCTGCTCCAGG - Intronic
1037879618 8:22566338-22566360 CGTGCAGCCCGGCCTCAGCCTGG + Exonic
1038156533 8:24996679-24996701 CTTTCACCCCAGTCTGATGCTGG + Intergenic
1046806787 8:118487367-118487389 CTTCCAGCCCCTCCTGGTCCTGG - Intronic
1048380192 8:133858871-133858893 CTAGCAGCACAGCCTCATCCTGG - Intergenic
1049100211 8:140573932-140573954 CCTCCAGTCCAGCCTGACCCAGG + Intronic
1049160600 8:141095441-141095463 CTTCCTGCCCAGCCTTACCCTGG + Intergenic
1049622693 8:143605762-143605784 CTCGCAGCCCGCCCTGCTCCAGG + Exonic
1053528220 9:38851255-38851277 CTTTCAGACCAGTGTGATCCAGG - Intergenic
1054637914 9:67512673-67512695 CTTTCAGACCAGTGTGATCCAGG + Intergenic
1055415656 9:76079993-76080015 CTTGCATCCCAACTTGATCATGG + Intronic
1056530047 9:87478923-87478945 AGTGCAGCCCAGCCTGGTGCTGG + Intergenic
1056756113 9:89382983-89383005 GCTGCAGCCCAGCCCCATCCGGG - Intronic
1059238706 9:112784655-112784677 CATGCAGCCTAGCCTGGACCAGG + Intronic
1061149911 9:128822785-128822807 CCTGCAGCCTGGCCTCATCCAGG - Exonic
1061226825 9:129285158-129285180 CTCTCAGCCCAGCCAGAACCAGG - Intergenic
1061609371 9:131736304-131736326 CCTGCATCCCAGCTTGTTCCTGG + Intronic
1061741086 9:132706818-132706840 CTTGCATCCCAGCCTGGACCTGG - Intergenic
1062376147 9:136262747-136262769 CCTGCAGCCCAGCCTGGAGCAGG + Intergenic
1062468985 9:136694030-136694052 ACTGCAGCCCTGCCTGCTCCTGG + Intergenic
1062745943 9:138212072-138212094 CCTGGAGCCCAGGCTGCTCCAGG + Intergenic
1190191039 X:48277583-48277605 CTTGCAGGTCAGACTGCTCCCGG - Intergenic
1190194397 X:48304852-48304874 CTTGCAGGACAGACTGCTCCCGG - Intergenic
1190247267 X:48698880-48698902 CTTTCTGCCCCGCTTGATCCAGG + Exonic
1190660905 X:52653477-52653499 CTTGCAGGTCAGACTGCTCCTGG - Exonic
1190667091 X:52705754-52705776 CTTGCAGGTCAGACTGCTCCCGG - Exonic
1190672327 X:52752654-52752676 CTTGCAGGTCAGACTGCTCCCGG + Exonic
1191843574 X:65529967-65529989 CTTGGAGCCAAGCCTTTTCCTGG - Intronic
1194769793 X:97887685-97887707 TTTGCCGCCCAGGCTGATCTCGG - Intergenic
1195958847 X:110364251-110364273 TTTACAGCCCACCCTAATCCAGG + Intronic
1199672349 X:150158037-150158059 CTTGGTACCCAGCCTGAACCAGG - Intergenic
1199718772 X:150526885-150526907 CTTGCAGCCCAGCCAGCGCCAGG - Intergenic