ID: 1141972430

View in Genome Browser
Species Human (GRCh38)
Location 16:87492711-87492733
Sequence CTGGGCGGAGGCGCGGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141972430_1141972446 7 Left 1141972430 16:87492711-87492733 CCGCCGCCCGCGCCTCCGCCCAG No data
Right 1141972446 16:87492741-87492763 GTTACCCCGGGCCGCGGGCGCGG No data
1141972430_1141972451 20 Left 1141972430 16:87492711-87492733 CCGCCGCCCGCGCCTCCGCCCAG No data
Right 1141972451 16:87492754-87492776 GCGGGCGCGGCGTCGCCGCCTGG No data
1141972430_1141972452 21 Left 1141972430 16:87492711-87492733 CCGCCGCCCGCGCCTCCGCCCAG No data
Right 1141972452 16:87492755-87492777 CGGGCGCGGCGTCGCCGCCTGGG No data
1141972430_1141972440 -5 Left 1141972430 16:87492711-87492733 CCGCCGCCCGCGCCTCCGCCCAG No data
Right 1141972440 16:87492729-87492751 CCCAGGCCGGCCGTTACCCCGGG No data
1141972430_1141972453 22 Left 1141972430 16:87492711-87492733 CCGCCGCCCGCGCCTCCGCCCAG No data
Right 1141972453 16:87492756-87492778 GGGCGCGGCGTCGCCGCCTGGGG No data
1141972430_1141972443 1 Left 1141972430 16:87492711-87492733 CCGCCGCCCGCGCCTCCGCCCAG No data
Right 1141972443 16:87492735-87492757 CCGGCCGTTACCCCGGGCCGCGG No data
1141972430_1141972454 30 Left 1141972430 16:87492711-87492733 CCGCCGCCCGCGCCTCCGCCCAG No data
Right 1141972454 16:87492764-87492786 CGTCGCCGCCTGGGGAGCGCTGG No data
1141972430_1141972444 2 Left 1141972430 16:87492711-87492733 CCGCCGCCCGCGCCTCCGCCCAG No data
Right 1141972444 16:87492736-87492758 CGGCCGTTACCCCGGGCCGCGGG No data
1141972430_1141972438 -6 Left 1141972430 16:87492711-87492733 CCGCCGCCCGCGCCTCCGCCCAG No data
Right 1141972438 16:87492728-87492750 GCCCAGGCCGGCCGTTACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141972430 Original CRISPR CTGGGCGGAGGCGCGGGCGG CGG (reversed) Intergenic