ID: 1141972435

View in Genome Browser
Species Human (GRCh38)
Location 16:87492718-87492740
Sequence GGCCGGCCTGGGCGGAGGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141972435_1141972454 23 Left 1141972435 16:87492718-87492740 CCGCGCCTCCGCCCAGGCCGGCC No data
Right 1141972454 16:87492764-87492786 CGTCGCCGCCTGGGGAGCGCTGG No data
1141972435_1141972451 13 Left 1141972435 16:87492718-87492740 CCGCGCCTCCGCCCAGGCCGGCC No data
Right 1141972451 16:87492754-87492776 GCGGGCGCGGCGTCGCCGCCTGG No data
1141972435_1141972444 -5 Left 1141972435 16:87492718-87492740 CCGCGCCTCCGCCCAGGCCGGCC No data
Right 1141972444 16:87492736-87492758 CGGCCGTTACCCCGGGCCGCGGG No data
1141972435_1141972456 25 Left 1141972435 16:87492718-87492740 CCGCGCCTCCGCCCAGGCCGGCC No data
Right 1141972456 16:87492766-87492788 TCGCCGCCTGGGGAGCGCTGGGG No data
1141972435_1141972457 26 Left 1141972435 16:87492718-87492740 CCGCGCCTCCGCCCAGGCCGGCC No data
Right 1141972457 16:87492767-87492789 CGCCGCCTGGGGAGCGCTGGGGG No data
1141972435_1141972443 -6 Left 1141972435 16:87492718-87492740 CCGCGCCTCCGCCCAGGCCGGCC No data
Right 1141972443 16:87492735-87492757 CCGGCCGTTACCCCGGGCCGCGG No data
1141972435_1141972455 24 Left 1141972435 16:87492718-87492740 CCGCGCCTCCGCCCAGGCCGGCC No data
Right 1141972455 16:87492765-87492787 GTCGCCGCCTGGGGAGCGCTGGG No data
1141972435_1141972446 0 Left 1141972435 16:87492718-87492740 CCGCGCCTCCGCCCAGGCCGGCC No data
Right 1141972446 16:87492741-87492763 GTTACCCCGGGCCGCGGGCGCGG No data
1141972435_1141972452 14 Left 1141972435 16:87492718-87492740 CCGCGCCTCCGCCCAGGCCGGCC No data
Right 1141972452 16:87492755-87492777 CGGGCGCGGCGTCGCCGCCTGGG No data
1141972435_1141972453 15 Left 1141972435 16:87492718-87492740 CCGCGCCTCCGCCCAGGCCGGCC No data
Right 1141972453 16:87492756-87492778 GGGCGCGGCGTCGCCGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141972435 Original CRISPR GGCCGGCCTGGGCGGAGGCG CGG (reversed) Intergenic