ID: 1141972436

View in Genome Browser
Species Human (GRCh38)
Location 16:87492723-87492745
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141972436_1141972454 18 Left 1141972436 16:87492723-87492745 CCTCCGCCCAGGCCGGCCGTTAC No data
Right 1141972454 16:87492764-87492786 CGTCGCCGCCTGGGGAGCGCTGG No data
1141972436_1141972446 -5 Left 1141972436 16:87492723-87492745 CCTCCGCCCAGGCCGGCCGTTAC No data
Right 1141972446 16:87492741-87492763 GTTACCCCGGGCCGCGGGCGCGG No data
1141972436_1141972444 -10 Left 1141972436 16:87492723-87492745 CCTCCGCCCAGGCCGGCCGTTAC No data
Right 1141972444 16:87492736-87492758 CGGCCGTTACCCCGGGCCGCGGG No data
1141972436_1141972456 20 Left 1141972436 16:87492723-87492745 CCTCCGCCCAGGCCGGCCGTTAC No data
Right 1141972456 16:87492766-87492788 TCGCCGCCTGGGGAGCGCTGGGG No data
1141972436_1141972452 9 Left 1141972436 16:87492723-87492745 CCTCCGCCCAGGCCGGCCGTTAC No data
Right 1141972452 16:87492755-87492777 CGGGCGCGGCGTCGCCGCCTGGG No data
1141972436_1141972455 19 Left 1141972436 16:87492723-87492745 CCTCCGCCCAGGCCGGCCGTTAC No data
Right 1141972455 16:87492765-87492787 GTCGCCGCCTGGGGAGCGCTGGG No data
1141972436_1141972451 8 Left 1141972436 16:87492723-87492745 CCTCCGCCCAGGCCGGCCGTTAC No data
Right 1141972451 16:87492754-87492776 GCGGGCGCGGCGTCGCCGCCTGG No data
1141972436_1141972460 27 Left 1141972436 16:87492723-87492745 CCTCCGCCCAGGCCGGCCGTTAC No data
Right 1141972460 16:87492773-87492795 CTGGGGAGCGCTGGGGGCCGCGG No data
1141972436_1141972453 10 Left 1141972436 16:87492723-87492745 CCTCCGCCCAGGCCGGCCGTTAC No data
Right 1141972453 16:87492756-87492778 GGGCGCGGCGTCGCCGCCTGGGG No data
1141972436_1141972457 21 Left 1141972436 16:87492723-87492745 CCTCCGCCCAGGCCGGCCGTTAC No data
Right 1141972457 16:87492767-87492789 CGCCGCCTGGGGAGCGCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141972436 Original CRISPR GTAACGGCCGGCCTGGGCGG AGG (reversed) Intergenic