ID: 1141972437

View in Genome Browser
Species Human (GRCh38)
Location 16:87492726-87492748
Sequence GGGGTAACGGCCGGCCTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141972437_1141972456 17 Left 1141972437 16:87492726-87492748 CCGCCCAGGCCGGCCGTTACCCC No data
Right 1141972456 16:87492766-87492788 TCGCCGCCTGGGGAGCGCTGGGG No data
1141972437_1141972446 -8 Left 1141972437 16:87492726-87492748 CCGCCCAGGCCGGCCGTTACCCC No data
Right 1141972446 16:87492741-87492763 GTTACCCCGGGCCGCGGGCGCGG No data
1141972437_1141972452 6 Left 1141972437 16:87492726-87492748 CCGCCCAGGCCGGCCGTTACCCC No data
Right 1141972452 16:87492755-87492777 CGGGCGCGGCGTCGCCGCCTGGG No data
1141972437_1141972460 24 Left 1141972437 16:87492726-87492748 CCGCCCAGGCCGGCCGTTACCCC No data
Right 1141972460 16:87492773-87492795 CTGGGGAGCGCTGGGGGCCGCGG No data
1141972437_1141972457 18 Left 1141972437 16:87492726-87492748 CCGCCCAGGCCGGCCGTTACCCC No data
Right 1141972457 16:87492767-87492789 CGCCGCCTGGGGAGCGCTGGGGG No data
1141972437_1141972453 7 Left 1141972437 16:87492726-87492748 CCGCCCAGGCCGGCCGTTACCCC No data
Right 1141972453 16:87492756-87492778 GGGCGCGGCGTCGCCGCCTGGGG No data
1141972437_1141972455 16 Left 1141972437 16:87492726-87492748 CCGCCCAGGCCGGCCGTTACCCC No data
Right 1141972455 16:87492765-87492787 GTCGCCGCCTGGGGAGCGCTGGG No data
1141972437_1141972454 15 Left 1141972437 16:87492726-87492748 CCGCCCAGGCCGGCCGTTACCCC No data
Right 1141972454 16:87492764-87492786 CGTCGCCGCCTGGGGAGCGCTGG No data
1141972437_1141972451 5 Left 1141972437 16:87492726-87492748 CCGCCCAGGCCGGCCGTTACCCC No data
Right 1141972451 16:87492754-87492776 GCGGGCGCGGCGTCGCCGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141972437 Original CRISPR GGGGTAACGGCCGGCCTGGG CGG (reversed) Intergenic