ID: 1141972442

View in Genome Browser
Species Human (GRCh38)
Location 16:87492735-87492757
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141972442_1141972454 6 Left 1141972442 16:87492735-87492757 CCGGCCGTTACCCCGGGCCGCGG No data
Right 1141972454 16:87492764-87492786 CGTCGCCGCCTGGGGAGCGCTGG No data
1141972442_1141972460 15 Left 1141972442 16:87492735-87492757 CCGGCCGTTACCCCGGGCCGCGG No data
Right 1141972460 16:87492773-87492795 CTGGGGAGCGCTGGGGGCCGCGG No data
1141972442_1141972451 -4 Left 1141972442 16:87492735-87492757 CCGGCCGTTACCCCGGGCCGCGG No data
Right 1141972451 16:87492754-87492776 GCGGGCGCGGCGTCGCCGCCTGG No data
1141972442_1141972455 7 Left 1141972442 16:87492735-87492757 CCGGCCGTTACCCCGGGCCGCGG No data
Right 1141972455 16:87492765-87492787 GTCGCCGCCTGGGGAGCGCTGGG No data
1141972442_1141972452 -3 Left 1141972442 16:87492735-87492757 CCGGCCGTTACCCCGGGCCGCGG No data
Right 1141972452 16:87492755-87492777 CGGGCGCGGCGTCGCCGCCTGGG No data
1141972442_1141972461 26 Left 1141972442 16:87492735-87492757 CCGGCCGTTACCCCGGGCCGCGG No data
Right 1141972461 16:87492784-87492806 TGGGGGCCGCGGCCGCGAAACGG No data
1141972442_1141972456 8 Left 1141972442 16:87492735-87492757 CCGGCCGTTACCCCGGGCCGCGG No data
Right 1141972456 16:87492766-87492788 TCGCCGCCTGGGGAGCGCTGGGG No data
1141972442_1141972457 9 Left 1141972442 16:87492735-87492757 CCGGCCGTTACCCCGGGCCGCGG No data
Right 1141972457 16:87492767-87492789 CGCCGCCTGGGGAGCGCTGGGGG No data
1141972442_1141972453 -2 Left 1141972442 16:87492735-87492757 CCGGCCGTTACCCCGGGCCGCGG No data
Right 1141972453 16:87492756-87492778 GGGCGCGGCGTCGCCGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141972442 Original CRISPR CCGCGGCCCGGGGTAACGGC CGG (reversed) Intergenic