ID: 1141972447

View in Genome Browser
Species Human (GRCh38)
Location 16:87492745-87492767
Sequence GACGCCGCGCCCGCGGCCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141972447_1141972456 -2 Left 1141972447 16:87492745-87492767 CCCCGGGCCGCGGGCGCGGCGTC No data
Right 1141972456 16:87492766-87492788 TCGCCGCCTGGGGAGCGCTGGGG No data
1141972447_1141972468 29 Left 1141972447 16:87492745-87492767 CCCCGGGCCGCGGGCGCGGCGTC No data
Right 1141972468 16:87492797-87492819 CGCGAAACGGACGCTGGAGGGGG No data
1141972447_1141972464 26 Left 1141972447 16:87492745-87492767 CCCCGGGCCGCGGGCGCGGCGTC No data
Right 1141972464 16:87492794-87492816 GGCCGCGAAACGGACGCTGGAGG No data
1141972447_1141972460 5 Left 1141972447 16:87492745-87492767 CCCCGGGCCGCGGGCGCGGCGTC No data
Right 1141972460 16:87492773-87492795 CTGGGGAGCGCTGGGGGCCGCGG No data
1141972447_1141972467 28 Left 1141972447 16:87492745-87492767 CCCCGGGCCGCGGGCGCGGCGTC No data
Right 1141972467 16:87492796-87492818 CCGCGAAACGGACGCTGGAGGGG No data
1141972447_1141972457 -1 Left 1141972447 16:87492745-87492767 CCCCGGGCCGCGGGCGCGGCGTC No data
Right 1141972457 16:87492767-87492789 CGCCGCCTGGGGAGCGCTGGGGG No data
1141972447_1141972463 23 Left 1141972447 16:87492745-87492767 CCCCGGGCCGCGGGCGCGGCGTC No data
Right 1141972463 16:87492791-87492813 CGCGGCCGCGAAACGGACGCTGG No data
1141972447_1141972461 16 Left 1141972447 16:87492745-87492767 CCCCGGGCCGCGGGCGCGGCGTC No data
Right 1141972461 16:87492784-87492806 TGGGGGCCGCGGCCGCGAAACGG No data
1141972447_1141972455 -3 Left 1141972447 16:87492745-87492767 CCCCGGGCCGCGGGCGCGGCGTC No data
Right 1141972455 16:87492765-87492787 GTCGCCGCCTGGGGAGCGCTGGG No data
1141972447_1141972465 27 Left 1141972447 16:87492745-87492767 CCCCGGGCCGCGGGCGCGGCGTC No data
Right 1141972465 16:87492795-87492817 GCCGCGAAACGGACGCTGGAGGG No data
1141972447_1141972454 -4 Left 1141972447 16:87492745-87492767 CCCCGGGCCGCGGGCGCGGCGTC No data
Right 1141972454 16:87492764-87492786 CGTCGCCGCCTGGGGAGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141972447 Original CRISPR GACGCCGCGCCCGCGGCCCG GGG (reversed) Intergenic