ID: 1141972449

View in Genome Browser
Species Human (GRCh38)
Location 16:87492747-87492769
Sequence GCGACGCCGCGCCCGCGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141972449_1141972455 -5 Left 1141972449 16:87492747-87492769 CCGGGCCGCGGGCGCGGCGTCGC No data
Right 1141972455 16:87492765-87492787 GTCGCCGCCTGGGGAGCGCTGGG No data
1141972449_1141972461 14 Left 1141972449 16:87492747-87492769 CCGGGCCGCGGGCGCGGCGTCGC No data
Right 1141972461 16:87492784-87492806 TGGGGGCCGCGGCCGCGAAACGG No data
1141972449_1141972465 25 Left 1141972449 16:87492747-87492769 CCGGGCCGCGGGCGCGGCGTCGC No data
Right 1141972465 16:87492795-87492817 GCCGCGAAACGGACGCTGGAGGG No data
1141972449_1141972467 26 Left 1141972449 16:87492747-87492769 CCGGGCCGCGGGCGCGGCGTCGC No data
Right 1141972467 16:87492796-87492818 CCGCGAAACGGACGCTGGAGGGG No data
1141972449_1141972469 30 Left 1141972449 16:87492747-87492769 CCGGGCCGCGGGCGCGGCGTCGC No data
Right 1141972469 16:87492800-87492822 GAAACGGACGCTGGAGGGGGAGG No data
1141972449_1141972456 -4 Left 1141972449 16:87492747-87492769 CCGGGCCGCGGGCGCGGCGTCGC No data
Right 1141972456 16:87492766-87492788 TCGCCGCCTGGGGAGCGCTGGGG No data
1141972449_1141972464 24 Left 1141972449 16:87492747-87492769 CCGGGCCGCGGGCGCGGCGTCGC No data
Right 1141972464 16:87492794-87492816 GGCCGCGAAACGGACGCTGGAGG No data
1141972449_1141972463 21 Left 1141972449 16:87492747-87492769 CCGGGCCGCGGGCGCGGCGTCGC No data
Right 1141972463 16:87492791-87492813 CGCGGCCGCGAAACGGACGCTGG No data
1141972449_1141972457 -3 Left 1141972449 16:87492747-87492769 CCGGGCCGCGGGCGCGGCGTCGC No data
Right 1141972457 16:87492767-87492789 CGCCGCCTGGGGAGCGCTGGGGG No data
1141972449_1141972468 27 Left 1141972449 16:87492747-87492769 CCGGGCCGCGGGCGCGGCGTCGC No data
Right 1141972468 16:87492797-87492819 CGCGAAACGGACGCTGGAGGGGG No data
1141972449_1141972454 -6 Left 1141972449 16:87492747-87492769 CCGGGCCGCGGGCGCGGCGTCGC No data
Right 1141972454 16:87492764-87492786 CGTCGCCGCCTGGGGAGCGCTGG No data
1141972449_1141972460 3 Left 1141972449 16:87492747-87492769 CCGGGCCGCGGGCGCGGCGTCGC No data
Right 1141972460 16:87492773-87492795 CTGGGGAGCGCTGGGGGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141972449 Original CRISPR GCGACGCCGCGCCCGCGGCC CGG (reversed) Intergenic