ID: 1141972452

View in Genome Browser
Species Human (GRCh38)
Location 16:87492755-87492777
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141972436_1141972452 9 Left 1141972436 16:87492723-87492745 CCTCCGCCCAGGCCGGCCGTTAC No data
Right 1141972452 16:87492755-87492777 CGGGCGCGGCGTCGCCGCCTGGG No data
1141972439_1141972452 3 Left 1141972439 16:87492729-87492751 CCCAGGCCGGCCGTTACCCCGGG No data
Right 1141972452 16:87492755-87492777 CGGGCGCGGCGTCGCCGCCTGGG No data
1141972430_1141972452 21 Left 1141972430 16:87492711-87492733 CCGCCGCCCGCGCCTCCGCCCAG No data
Right 1141972452 16:87492755-87492777 CGGGCGCGGCGTCGCCGCCTGGG No data
1141972434_1141972452 15 Left 1141972434 16:87492717-87492739 CCCGCGCCTCCGCCCAGGCCGGC No data
Right 1141972452 16:87492755-87492777 CGGGCGCGGCGTCGCCGCCTGGG No data
1141972445_1141972452 -7 Left 1141972445 16:87492739-87492761 CCGTTACCCCGGGCCGCGGGCGC No data
Right 1141972452 16:87492755-87492777 CGGGCGCGGCGTCGCCGCCTGGG No data
1141972441_1141972452 2 Left 1141972441 16:87492730-87492752 CCAGGCCGGCCGTTACCCCGGGC No data
Right 1141972452 16:87492755-87492777 CGGGCGCGGCGTCGCCGCCTGGG No data
1141972442_1141972452 -3 Left 1141972442 16:87492735-87492757 CCGGCCGTTACCCCGGGCCGCGG No data
Right 1141972452 16:87492755-87492777 CGGGCGCGGCGTCGCCGCCTGGG No data
1141972432_1141972452 18 Left 1141972432 16:87492714-87492736 CCGCCCGCGCCTCCGCCCAGGCC No data
Right 1141972452 16:87492755-87492777 CGGGCGCGGCGTCGCCGCCTGGG No data
1141972435_1141972452 14 Left 1141972435 16:87492718-87492740 CCGCGCCTCCGCCCAGGCCGGCC No data
Right 1141972452 16:87492755-87492777 CGGGCGCGGCGTCGCCGCCTGGG No data
1141972429_1141972452 27 Left 1141972429 16:87492705-87492727 CCGTCGCCGCCGCCCGCGCCTCC No data
Right 1141972452 16:87492755-87492777 CGGGCGCGGCGTCGCCGCCTGGG No data
1141972437_1141972452 6 Left 1141972437 16:87492726-87492748 CCGCCCAGGCCGGCCGTTACCCC No data
Right 1141972452 16:87492755-87492777 CGGGCGCGGCGTCGCCGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141972452 Original CRISPR CGGGCGCGGCGTCGCCGCCT GGG Intergenic