ID: 1141972460

View in Genome Browser
Species Human (GRCh38)
Location 16:87492773-87492795
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141972447_1141972460 5 Left 1141972447 16:87492745-87492767 CCCCGGGCCGCGGGCGCGGCGTC No data
Right 1141972460 16:87492773-87492795 CTGGGGAGCGCTGGGGGCCGCGG No data
1141972441_1141972460 20 Left 1141972441 16:87492730-87492752 CCAGGCCGGCCGTTACCCCGGGC No data
Right 1141972460 16:87492773-87492795 CTGGGGAGCGCTGGGGGCCGCGG No data
1141972442_1141972460 15 Left 1141972442 16:87492735-87492757 CCGGCCGTTACCCCGGGCCGCGG No data
Right 1141972460 16:87492773-87492795 CTGGGGAGCGCTGGGGGCCGCGG No data
1141972436_1141972460 27 Left 1141972436 16:87492723-87492745 CCTCCGCCCAGGCCGGCCGTTAC No data
Right 1141972460 16:87492773-87492795 CTGGGGAGCGCTGGGGGCCGCGG No data
1141972439_1141972460 21 Left 1141972439 16:87492729-87492751 CCCAGGCCGGCCGTTACCCCGGG No data
Right 1141972460 16:87492773-87492795 CTGGGGAGCGCTGGGGGCCGCGG No data
1141972450_1141972460 -2 Left 1141972450 16:87492752-87492774 CCGCGGGCGCGGCGTCGCCGCCT No data
Right 1141972460 16:87492773-87492795 CTGGGGAGCGCTGGGGGCCGCGG No data
1141972448_1141972460 4 Left 1141972448 16:87492746-87492768 CCCGGGCCGCGGGCGCGGCGTCG No data
Right 1141972460 16:87492773-87492795 CTGGGGAGCGCTGGGGGCCGCGG No data
1141972449_1141972460 3 Left 1141972449 16:87492747-87492769 CCGGGCCGCGGGCGCGGCGTCGC No data
Right 1141972460 16:87492773-87492795 CTGGGGAGCGCTGGGGGCCGCGG No data
1141972437_1141972460 24 Left 1141972437 16:87492726-87492748 CCGCCCAGGCCGGCCGTTACCCC No data
Right 1141972460 16:87492773-87492795 CTGGGGAGCGCTGGGGGCCGCGG No data
1141972445_1141972460 11 Left 1141972445 16:87492739-87492761 CCGTTACCCCGGGCCGCGGGCGC No data
Right 1141972460 16:87492773-87492795 CTGGGGAGCGCTGGGGGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141972460 Original CRISPR CTGGGGAGCGCTGGGGGCCG CGG Intergenic