ID: 1141972475

View in Genome Browser
Species Human (GRCh38)
Location 16:87492821-87492843
Sequence GGGACGCGCGGCGGGAGGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141972462_1141972475 8 Left 1141972462 16:87492790-87492812 CCGCGGCCGCGAAACGGACGCTG No data
Right 1141972475 16:87492821-87492843 GGGACGCGCGGCGGGAGGCGCGG No data
1141972466_1141972475 2 Left 1141972466 16:87492796-87492818 CCGCGAAACGGACGCTGGAGGGG No data
Right 1141972475 16:87492821-87492843 GGGACGCGCGGCGGGAGGCGCGG No data
1141972458_1141972475 29 Left 1141972458 16:87492769-87492791 CCGCCTGGGGAGCGCTGGGGGCC No data
Right 1141972475 16:87492821-87492843 GGGACGCGCGGCGGGAGGCGCGG No data
1141972459_1141972475 26 Left 1141972459 16:87492772-87492794 CCTGGGGAGCGCTGGGGGCCGCG No data
Right 1141972475 16:87492821-87492843 GGGACGCGCGGCGGGAGGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141972475 Original CRISPR GGGACGCGCGGCGGGAGGCG CGG Intergenic