ID: 1141972476 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:87492824-87492846 |
| Sequence | ACGCGCGGCGGGAGGCGCGG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1141972462_1141972476 | 11 | Left | 1141972462 | 16:87492790-87492812 | CCGCGGCCGCGAAACGGACGCTG | No data | ||
| Right | 1141972476 | 16:87492824-87492846 | ACGCGCGGCGGGAGGCGCGGAGG | No data | ||||
| 1141972459_1141972476 | 29 | Left | 1141972459 | 16:87492772-87492794 | CCTGGGGAGCGCTGGGGGCCGCG | No data | ||
| Right | 1141972476 | 16:87492824-87492846 | ACGCGCGGCGGGAGGCGCGGAGG | No data | ||||
| 1141972466_1141972476 | 5 | Left | 1141972466 | 16:87492796-87492818 | CCGCGAAACGGACGCTGGAGGGG | No data | ||
| Right | 1141972476 | 16:87492824-87492846 | ACGCGCGGCGGGAGGCGCGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1141972476 | Original CRISPR | ACGCGCGGCGGGAGGCGCGG AGG | Intergenic | ||